Mutagenetix > Incidental Mutation

Incidental Mutation 'R1398:Isg20l2'

160216

Institutional Source

Beutler Lab

Gene Symbol

Isg20l2

Ensembl Gene

ENSMUSG00000048039

Gene Name

interferon stimulated exonuclease gene 20-like 2

Synonyms

MMRRC Submission

039460-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.959) question?

Stock #

R1398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87930314-87940686 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 87938754 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 325 (L325I)

Ref Sequence

ENSEMBL: ENSMUSP00000059783 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055984]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000055984
AA Change: L325I

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000059783
Gene: ENSMUSG00000048039
AA Change: L325I

Domain	Start	End	E-Value	Type
low complexity region	128	145	N/A	INTRINSIC
low complexity region	157	168	N/A	INTRINSIC
EXOIII	193	359	3.34e-38	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that may be involved in the processing of the 12S pre-rRNA. Pseudogenes have been identified on chromosomes 6 and 11. [provided by RefSeq, Dec 2014]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,341	Q253K	possibly damaging	Het
9330182L06Rik	A	G	5: 9,380,297	Y69C	probably damaging	Het
Abca17	T	C	17: 24,328,537	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,256,736		probably null	Het
Anks1b	A	G	10: 90,050,029	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,295,296		probably benign	Het
C4b	T	A	17: 34,730,719		probably benign	Het
Cacna2d1	G	A	5: 16,357,766	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,781,971		probably benign	Het
Cep63	A	T	9: 102,603,086		probably benign	Het
Chil4	T	A	3: 106,219,509		probably null	Het
Cnot11	A	G	1: 39,545,180	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,638,625	S254P	probably damaging	Het
Dnah11	T	A	12: 118,057,106	K87*	probably null	Het
Dpy19l2	T	A	9: 24,581,263		probably benign	Het
Dsc1	A	T	18: 20,088,336	I694N	probably damaging	Het
Ehd4	A	T	2: 120,127,600	I168K	probably benign	Het
Eif4e	A	T	3: 138,546,375	N25Y	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam160b1	T	A	19: 57,372,926		probably benign	Het
Fgfrl1	T	A	5: 108,706,281		probably benign	Het
Gm3159	T	A	14: 4,398,586	Y92*	probably null	Het
Gm4922	T	A	10: 18,783,748	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,714,262		probably benign	Het
Grsf1	A	G	5: 88,665,847	Y231H	probably benign	Het
Heatr4	T	A	12: 83,967,621	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Kalrn	A	G	16: 34,212,820	Y879H	probably damaging	Het
Kcnk10	C	A	12: 98,436,226	W318L	probably damaging	Het
Kctd1	T	C	18: 15,062,597	E323G	possibly damaging	Het
Kif4	G	T	X: 100,689,097	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,627,732	T151A	unknown	Het
Ldlr	A	T	9: 21,739,542	Q449L	probably benign	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lgals12	C	T	19: 7,603,957		probably benign	Het
Lrig3	C	T	10: 126,003,088	P488L	probably benign	Het
Lrrc4b	A	C	7: 44,462,452	I583L	probably benign	Het
Lyst	T	C	13: 13,740,536	S3272P	possibly damaging	Het
March2	T	C	17: 33,696,122	H166R	probably damaging	Het
Mtbp	C	A	15: 55,577,537	Y373*	probably null	Het
Myh2	C	T	11: 67,185,287	H767Y	probably benign	Het
Ncam1	G	A	9: 49,517,589		probably benign	Het
Neb	T	A	2: 52,289,646	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,448,756	Y428H	possibly damaging	Het
Nrros	A	T	16: 32,143,144	I649N	probably damaging	Het
Nvl	A	T	1: 181,097,126		probably benign	Het
Olfr495	T	A	7: 108,395,501	V127E	probably damaging	Het
Pms1	A	T	1: 53,207,276	V368E	possibly damaging	Het
Polq	T	A	16: 37,062,495	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,542,879	V31A	probably damaging	Het
Rev3l	T	A	10: 39,821,583	V692E	probably benign	Het
Robo4	T	C	9: 37,408,076		probably null	Het
Rps6kc1	T	C	1: 190,800,015	I597V	probably damaging	Het
Rtel1	T	A	2: 181,335,865		probably null	Het
Scn9a	A	G	2: 66,484,586	M1587T	probably benign	Het
Sec31b	T	A	19: 44,523,665	I597F	probably benign	Het
Skint5	T	C	4: 113,779,071	N650S	unknown	Het
Slc22a28	G	T	19: 8,130,202	S167*	probably null	Het
Slfn1	T	A	11: 83,121,142	M28K	probably damaging	Het
Smc6	T	C	12: 11,271,879		probably benign	Het
Sox8	T	C	17: 25,567,883	H282R	probably benign	Het
Syngr3	C	A	17: 24,686,440	V161L	probably benign	Het
Trak1	C	T	9: 121,454,359	S397F	probably damaging	Het
Uso1	C	T	5: 92,181,468	A405V	probably benign	Het
Uvrag	G	T	7: 99,065,820	Y190*	probably null	Het
Vps13d	A	T	4: 145,099,983	L1726Q	probably null	Het
Vwf	A	T	6: 125,603,457	Q556L	probably benign	Het
Wdr70	T	A	15: 8,035,844	M246L	probably benign	Het
Yipf3	T	C	17: 46,251,446	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,826,873	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,627,297	F125L	probably benign	Het

Other mutations in Isg20l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Isg20l2	APN	3	87931761	missense	probably damaging	0.99
IGL02331:Isg20l2	APN	3	87932087	missense	probably damaging	0.99
FR4304:Isg20l2	UTSW	3	87931712	unclassified	probably benign
FR4340:Isg20l2	UTSW	3	87931712	nonsense	probably null
FR4449:Isg20l2	UTSW	3	87931713	unclassified	probably benign
FR4589:Isg20l2	UTSW	3	87931717	unclassified	probably benign
FR4976:Isg20l2	UTSW	3	87931715	nonsense	probably null
R0331:Isg20l2	UTSW	3	87931785	missense	probably damaging	1.00
R0465:Isg20l2	UTSW	3	87931680	missense	probably benign	0.01
R1679:Isg20l2	UTSW	3	87932085	missense	probably damaging	1.00
R3040:Isg20l2	UTSW	3	87931995	missense	probably benign
R4910:Isg20l2	UTSW	3	87939263	missense	probably damaging	1.00
R5015:Isg20l2	UTSW	3	87931981	missense	possibly damaging	0.52
R5247:Isg20l2	UTSW	3	87931613	missense	possibly damaging	0.71
R5591:Isg20l2	UTSW	3	87930424	unclassified	probably benign
R6261:Isg20l2	UTSW	3	87932088	missense	probably damaging	1.00
R6755:Isg20l2	UTSW	3	87931689	missense	probably benign	0.21
R7459:Isg20l2	UTSW	3	87932178	missense	possibly damaging	0.76
R9036:Isg20l2	UTSW	3	87931995	missense	probably benign
R9284:Isg20l2	UTSW	3	87931684	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- ATTGGGCCTTCACAATCTAAGGAGC -3'
(R):5'- AGGCAGGACATTTCAGGTCAAACAG -3'

Sequencing Primer
(F):5'- AGCTCCACCTTTGAGTATGG -3'
(R):5'- AAACAGACTGTCTGGGTCTTC -3'

Posted On

2014-03-14