Incidental Mutation 'R1398:Eif4e'
ID160218
Institutional Source Beutler Lab
Gene Symbol Eif4e
Ensembl Gene ENSMUSG00000028156
Gene Nameeukaryotic translation initiation factor 4E
SynonymsIf4e, eIF-4E
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138526179-138559696 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138546375 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 25 (N25Y)
Ref Sequence ENSEMBL: ENSMUSP00000143481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029803] [ENSMUST00000196990] [ENSMUST00000200020] [ENSMUST00000200100] [ENSMUST00000200239]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029803
AA Change: N25Y

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029803
Gene: ENSMUSG00000028156
AA Change: N25Y

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 199 8.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196990
SMART Domains Protein: ENSMUSP00000143104
Gene: ENSMUSG00000028156

DomainStartEndE-ValueType
Pfam:IF4E 1 115 1.4e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198252
Predicted Effect possibly damaging
Transcript: ENSMUST00000200020
AA Change: N25Y

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143690
Gene: ENSMUSG00000028156
AA Change: N25Y

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 183 1.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200100
AA Change: N25Y

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143772
Gene: ENSMUSG00000028156
AA Change: N25Y

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 31 167 3.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200239
AA Change: N25Y

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143481
Gene: ENSMUSG00000028156
AA Change: N25Y

DomainStartEndE-ValueType
low complexity region 3 23 N/A INTRINSIC
Pfam:IF4E 38 79 5.4e-9 PFAM
Meta Mutation Damage Score 0.0970 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: This gene encodes a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. It has also been associated with autism spectrum disorders. Consistently, knockout of this gene results in increased translation of neuroligins, postsynaptic proteins linked to autism spectrum disorders. Pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit resistance to developing prostate intraepithelial neoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Eif4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Eif4e APN 3 138547651 splice site probably benign
IGL03328:Eif4e APN 3 138553727 intron probably benign
R2010:Eif4e UTSW 3 138555458 missense probably benign 0.08
R3925:Eif4e UTSW 3 138555437 missense probably damaging 1.00
R6026:Eif4e UTSW 3 138550900 missense probably damaging 1.00
R7038:Eif4e UTSW 3 138527182 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCAGTAGAGTAGCCCGATTCTCC -3'
(R):5'- GAATAAGCCATGTTCCCAGAGCCC -3'

Sequencing Primer
(F):5'- TAGAGTAGCCCGATTCTCCTAGAG -3'
(R):5'- CTTTAACAAGAATCCTCTACAGGCTG -3'
Posted On2014-03-14