Incidental Mutation 'R1398:Hoxa13'
ID 160230
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Name homeobox A13
Synonyms Hox-1.10
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1398 (G1)
Quality Score 96.1
Status Not validated
Chromosome 6
Chromosomal Location 52235833-52237865 bp(-) (GRCm39)
Type of Mutation utr 5 prime
DNA Base Change (assembly) G to C at 52260648 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
AlphaFold Q62424
Predicted Effect unknown
Transcript: ENSMUST00000047993
AA Change: R43G
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203
AA Change: R43G

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect probably benign
Transcript: ENSMUST00000147595
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52,260,636 (GRCm38) frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0496:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0502:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0512:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0784:Hoxa13 UTSW 6 52,236,917 (GRCm39) missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1157:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1192:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1310:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1341:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1343:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1398:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52,236,917 (GRCm39) missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52,236,125 (GRCm39) missense probably damaging 0.98
R3149:Hoxa13 UTSW 6 52,237,284 (GRCm39) intron probably benign
R4012:Hoxa13 UTSW 6 52,236,107 (GRCm39) missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52,237,714 (GRCm39) utr 5 prime probably benign
R5535:Hoxa13 UTSW 6 52,237,520 (GRCm39) frame shift probably null
R6175:Hoxa13 UTSW 6 52,236,908 (GRCm39) missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52,236,862 (GRCm39) missense probably damaging 1.00
R7770:Hoxa13 UTSW 6 52,237,247 (GRCm39) critical splice acceptor site probably benign
R7926:Hoxa13 UTSW 6 52,237,619 (GRCm39) frame shift probably null
R7931:Hoxa13 UTSW 6 52,237,620 (GRCm39) frame shift probably null
R8960:Hoxa13 UTSW 6 52,236,976 (GRCm39) missense probably benign 0.03
R8982:Hoxa13 UTSW 6 52,235,916 (GRCm39) nonsense probably null
R9060:Hoxa13 UTSW 6 52,236,897 (GRCm39) missense probably damaging 1.00
R9698:Hoxa13 UTSW 6 52,236,024 (GRCm39) missense probably benign 0.00
X0018:Hoxa13 UTSW 6 52,237,099 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCGTAGCCCTGATGGTAGAAAGC -3'
(R):5'- TAAAACAGCGCCACTGGGGTCTTC -3'

Sequencing Primer
(F):5'- TGCCGAAGTAGCCGTAGG -3'
(R):5'- ACTGGGGTCTTCTCCATGC -3'
Posted On 2014-03-14