Incidental Mutation 'R1398:Vwf'
ID 160232
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
MMRRC Submission 039460-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R1398 (G1)
Quality Score 192
Status Validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 125603457 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 556 (Q556L)
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000112254
AA Change: Q556L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930
AA Change: Q556L

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1809:Vwf UTSW 6 125590175 splice site probably benign
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9136:Vwf UTSW 6 125599393 splice site probably benign
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
R9508:Vwf UTSW 6 125555508 missense
R9553:Vwf UTSW 6 125600699 missense
R9660:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9706:Vwf UTSW 6 125624573 missense
R9708:Vwf UTSW 6 125657090 missense
R9712:Vwf UTSW 6 125624573 missense
R9714:Vwf UTSW 6 125624573 missense
R9728:Vwf UTSW 6 125591707 missense possibly damaging 0.61
R9758:Vwf UTSW 6 125626267 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTAAGTGGAACCATTGTGGCACTG -3'
(R):5'- TCTTTTCCGGGCCAGAAACGAC -3'

Sequencing Primer
(F):5'- ATTGTGGCACTGGGGGAC -3'
(R):5'- TGAGCCAAATGTGGATCTCAAC -3'
Posted On 2014-03-14