Incidental Mutation 'R1398:Lrrc4b'
ID 160233
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Name leucine rich repeat containing 4B
Synonyms NGL-3, Lrig4, Ngl3
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1398 (G1)
Quality Score 217
Status Validated
Chromosome 7
Chromosomal Location 44091911-44112775 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 44111876 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 583 (I583L)
Ref Sequence ENSEMBL: ENSMUSP00000053123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156093] [ENSMUST00000156957]
AlphaFold P0C192
PDB Structure CRYSTAL STRUCTURE OF THE N-TERMINAL LEUCINE RICH REPEATS OF NETRIN-G LIGAND-3 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE N-TERMINAL LEUCINE RICH REPEATS AND IMMUNOGLOBULIN DOMAIN OF NETRIN-G LIGAND-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058667
AA Change: I583L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: I583L

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127790
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect probably benign
Transcript: ENSMUST00000156093
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156957
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207591
Meta Mutation Damage Score 0.1014 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44,111,739 (GRCm39) missense probably damaging 0.99
R1421:Lrrc4b UTSW 7 44,110,475 (GRCm39) missense probably benign 0.00
R1622:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R1681:Lrrc4b UTSW 7 44,110,601 (GRCm39) missense probably damaging 0.99
R1778:Lrrc4b UTSW 7 44,111,823 (GRCm39) missense probably benign
R1967:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R1989:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R2427:Lrrc4b UTSW 7 44,111,976 (GRCm39) missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44,111,982 (GRCm39) missense probably damaging 1.00
R3822:Lrrc4b UTSW 7 44,111,982 (GRCm39) missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44,111,796 (GRCm39) splice site probably null
R5249:Lrrc4b UTSW 7 44,111,988 (GRCm39) missense possibly damaging 0.93
R5268:Lrrc4b UTSW 7 44,110,787 (GRCm39) missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44,111,754 (GRCm39) missense probably benign 0.00
R6984:Lrrc4b UTSW 7 44,110,722 (GRCm39) missense possibly damaging 0.62
R7003:Lrrc4b UTSW 7 44,094,580 (GRCm39) missense probably damaging 1.00
R7392:Lrrc4b UTSW 7 44,111,439 (GRCm39) missense probably damaging 1.00
R7544:Lrrc4b UTSW 7 44,111,975 (GRCm39) missense probably damaging 1.00
R7582:Lrrc4b UTSW 7 44,111,234 (GRCm39) missense probably benign 0.00
R7596:Lrrc4b UTSW 7 44,111,310 (GRCm39) missense probably damaging 1.00
R7830:Lrrc4b UTSW 7 44,111,231 (GRCm39) missense possibly damaging 0.76
R7836:Lrrc4b UTSW 7 44,094,316 (GRCm39) start gained probably benign
R8116:Lrrc4b UTSW 7 44,110,533 (GRCm39) missense probably damaging 1.00
R8147:Lrrc4b UTSW 7 44,111,829 (GRCm39) missense probably damaging 1.00
R8376:Lrrc4b UTSW 7 44,112,018 (GRCm39) missense probably benign 0.00
R9226:Lrrc4b UTSW 7 44,112,099 (GRCm39) missense possibly damaging 0.85
R9674:Lrrc4b UTSW 7 44,111,852 (GRCm39) missense probably damaging 1.00
Z1176:Lrrc4b UTSW 7 44,110,736 (GRCm39) frame shift probably null
Z1176:Lrrc4b UTSW 7 44,094,547 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc4b UTSW 7 44,111,335 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc4b UTSW 7 44,094,404 (GRCm39) missense unknown
Z1177:Lrrc4b UTSW 7 44,094,403 (GRCm39) missense unknown
Z1177:Lrrc4b UTSW 7 44,112,041 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGGATACACCTACTTCACCACGG -3'
(R):5'- TTGCTCGGCAAGCAGGAGCATC -3'

Sequencing Primer
(F):5'- TACTGAGAAGGAGCCCCC -3'
(R):5'- CTCTTGAAGAGCAGAGGTTCG -3'
Posted On 2014-03-14