Mutagenetix > Incidental Mutations

Incidental Mutation 'R1398:Ldlr'

160237

Institutional Source

Beutler Lab

Gene Symbol

Ldlr

Ensembl Gene

ENSMUSG00000032193

Gene Name

low density lipoprotein receptor

Synonyms

MMRRC Submission

039460-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21723483-21749919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21739542 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 449 (Q449L)

Ref Sequence

ENSEMBL: ENSMUSP00000034713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]

Predicted Effect

probably benign
Transcript: ENSMUST00000034713
AA Change: Q449L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: Q449L

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
LDLa	26	65	1.89e-14	SMART
LDLa	67	106	9.81e-13	SMART
EGF_like	108	144	6.81e1	SMART
LDLa	108	145	3.77e-14	SMART
LDLa	147	186	6.67e-15	SMART
LDLa	197	234	1.16e-14	SMART
LDLa	236	273	3.24e-13	SMART
LDLa	276	316	1e-9	SMART
EGF	318	354	3.2e-4	SMART
EGF_CA	355	394	4.09e-11	SMART
LY	420	462	1.11e-3	SMART
LY	466	508	4.7e-11	SMART
LY	509	552	5.23e-9	SMART
LY	553	595	7.86e-13	SMART
LY	596	639	3.25e-5	SMART
EGF	666	713	7.64e-2	SMART
low complexity region	799	811	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000213114
AA Change: Q449L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217613

Meta Mutation Damage Score

0.5083

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,341	Q253K	possibly damaging	Het
9330182L06Rik	A	G	5: 9,380,297	Y69C	probably damaging	Het
Abca17	T	C	17: 24,328,537	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,256,736		probably null	Het
Anks1b	A	G	10: 90,050,029	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,295,296		probably benign	Het
C4b	T	A	17: 34,730,719		probably benign	Het
Cacna2d1	G	A	5: 16,357,766	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,781,971		probably benign	Het
Cep63	A	T	9: 102,603,086		probably benign	Het
Chil4	T	A	3: 106,219,509		probably null	Het
Cnot11	A	G	1: 39,545,180	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,638,625	S254P	probably damaging	Het
Dnah11	T	A	12: 118,057,106	K87*	probably null	Het
Dpy19l2	T	A	9: 24,581,263		probably benign	Het
Dsc1	A	T	18: 20,088,336	I694N	probably damaging	Het
Ehd4	A	T	2: 120,127,600	I168K	probably benign	Het
Eif4e	A	T	3: 138,546,375	N25Y	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam160b1	T	A	19: 57,372,926		probably benign	Het
Fgfrl1	T	A	5: 108,706,281		probably benign	Het
Gm3159	T	A	14: 4,398,586	Y92*	probably null	Het
Gm4922	T	A	10: 18,783,748	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,714,262		probably benign	Het
Grsf1	A	G	5: 88,665,847	Y231H	probably benign	Het
Heatr4	T	A	12: 83,967,621	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Isg20l2	C	A	3: 87,938,754	L325I	probably benign	Het
Kalrn	A	G	16: 34,212,820	Y879H	probably damaging	Het
Kcnk10	C	A	12: 98,436,226	W318L	probably damaging	Het
Kctd1	T	C	18: 15,062,597	E323G	possibly damaging	Het
Kif4	G	T	X: 100,689,097	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,627,732	T151A	unknown	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lgals12	C	T	19: 7,603,957		probably benign	Het
Lrig3	C	T	10: 126,003,088	P488L	probably benign	Het
Lrrc4b	A	C	7: 44,462,452	I583L	probably benign	Het
Lyst	T	C	13: 13,740,536	S3272P	possibly damaging	Het
March2	T	C	17: 33,696,122	H166R	probably damaging	Het
Mtbp	C	A	15: 55,577,537	Y373*	probably null	Het
Myh2	C	T	11: 67,185,287	H767Y	probably benign	Het
Ncam1	G	A	9: 49,517,589		probably benign	Het
Neb	T	A	2: 52,289,646	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,448,756	Y428H	possibly damaging	Het
Nrros	A	T	16: 32,143,144	I649N	probably damaging	Het
Nvl	A	T	1: 181,097,126		probably benign	Het
Olfr495	T	A	7: 108,395,501	V127E	probably damaging	Het
Pms1	A	T	1: 53,207,276	V368E	possibly damaging	Het
Polq	T	A	16: 37,062,495	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,542,879	V31A	probably damaging	Het
Rev3l	T	A	10: 39,821,583	V692E	probably benign	Het
Robo4	T	C	9: 37,408,076		probably null	Het
Rps6kc1	T	C	1: 190,800,015	I597V	probably damaging	Het
Rtel1	T	A	2: 181,335,865		probably null	Het
Scn9a	A	G	2: 66,484,586	M1587T	probably benign	Het
Sec31b	T	A	19: 44,523,665	I597F	probably benign	Het
Skint5	T	C	4: 113,779,071	N650S	unknown	Het
Slc22a28	G	T	19: 8,130,202	S167*	probably null	Het
Slfn1	T	A	11: 83,121,142	M28K	probably damaging	Het
Smc6	T	C	12: 11,271,879		probably benign	Het
Sox8	T	C	17: 25,567,883	H282R	probably benign	Het
Syngr3	C	A	17: 24,686,440	V161L	probably benign	Het
Trak1	C	T	9: 121,454,359	S397F	probably damaging	Het
Uso1	C	T	5: 92,181,468	A405V	probably benign	Het
Uvrag	G	T	7: 99,065,820	Y190*	probably null	Het
Vps13d	A	T	4: 145,099,983	L1726Q	probably null	Het
Vwf	A	T	6: 125,603,457	Q556L	probably benign	Het
Wdr70	T	A	15: 8,035,844	M246L	probably benign	Het
Yipf3	T	C	17: 46,251,446	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,826,873	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,627,297	F125L	probably benign	Het

Other mutations in Ldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Ldlr	APN	9	21735361	critical splice donor site	probably null
IGL01975:Ldlr	APN	9	21733697	missense	probably benign	0.05
IGL02043:Ldlr	APN	9	21733499	missense	probably benign	0.03
IGL02524:Ldlr	APN	9	21733681	missense	probably damaging	1.00
IGL03049:Ldlr	APN	9	21745819	missense	probably benign	0.00
IGL03113:Ldlr	APN	9	21739828	missense	possibly damaging	0.85
R0240:Ldlr	UTSW	9	21737999	splice site	probably benign
R0586:Ldlr	UTSW	9	21739744	missense	probably benign	0.00
R1587:Ldlr	UTSW	9	21737913	missense	probably damaging	0.99
R2198:Ldlr	UTSW	9	21732402	missense	probably damaging	1.00
R3730:Ldlr	UTSW	9	21731801	missense	probably benign	0.09
R4422:Ldlr	UTSW	9	21737952	missense	probably damaging	1.00
R5044:Ldlr	UTSW	9	21735242	missense	probably benign	0.00
R5046:Ldlr	UTSW	9	21745907	critical splice donor site	probably null
R6186:Ldlr	UTSW	9	21723759	start gained	probably benign
R6195:Ldlr	UTSW	9	21731781	nonsense	probably null
R6523:Ldlr	UTSW	9	21737253	missense	probably damaging	1.00
R6682:Ldlr	UTSW	9	21732375	missense	probably benign
R7256:Ldlr	UTSW	9	21745744	missense	probably benign	0.01
R7384:Ldlr	UTSW	9	21739794	missense	probably benign	0.07
R7823:Ldlr	UTSW	9	21742306	critical splice donor site	probably null
R8065:Ldlr	UTSW	9	21737945	missense	probably damaging	1.00
R8223:Ldlr	UTSW	9	21747250	missense	probably damaging	1.00
R8732:Ldlr	UTSW	9	21739689	missense	probably benign	0.00
R8931:Ldlr	UTSW	9	21731812	missense	probably damaging	0.99
R8954:Ldlr	UTSW	9	21739532	missense	possibly damaging	0.87
X0024:Ldlr	UTSW	9	21739818	missense	probably damaging	1.00
Z1177:Ldlr	UTSW	9	21739830	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGGCTCCATAGGCTATCTGCTCTTC -3'
(R):5'- AGCTCTTTGGACACTCACCCATGC -3'

Sequencing Primer
(F):5'- ATAGGCTATCTGCTCTTCACCAAC -3'
(R):5'- TGGTGTCAGCCACAGATACG -3'

Posted On

2014-03-14