Incidental Mutation 'R1398:Robo4'
ID 160239
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Name roundabout guidance receptor 4
Synonyms Magic roundabout, 1200012D01Rik
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R1398 (G1)
Quality Score 187
Status Validated
Chromosome 9
Chromosomal Location 37313198-37325319 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 37319372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102895] [ENSMUST00000115046] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000214185]
AlphaFold Q8C310
Predicted Effect probably null
Transcript: ENSMUST00000102895
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115046
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115046
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115048
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect probably null
Transcript: ENSMUST00000214185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215777
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37,322,400 (GRCm39) missense probably damaging 1.00
IGL00392:Robo4 APN 9 37,319,525 (GRCm39) missense probably damaging 1.00
IGL00491:Robo4 APN 9 37,317,231 (GRCm39) missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37,319,507 (GRCm39) missense probably damaging 1.00
IGL01062:Robo4 APN 9 37,317,296 (GRCm39) missense probably benign 0.08
IGL01287:Robo4 APN 9 37,324,336 (GRCm39) missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37,319,496 (GRCm39) missense probably damaging 1.00
IGL02486:Robo4 APN 9 37,319,670 (GRCm39) missense probably damaging 1.00
IGL02851:Robo4 APN 9 37,324,678 (GRCm39) missense probably damaging 0.96
IGL02898:Robo4 APN 9 37,319,472 (GRCm39) missense probably damaging 0.99
IGL02965:Robo4 APN 9 37,321,765 (GRCm39) missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37,315,580 (GRCm39) splice site probably benign
IGL03102:Robo4 APN 9 37,315,481 (GRCm39) missense probably damaging 1.00
H8562:Robo4 UTSW 9 37,317,106 (GRCm39) intron probably benign
PIT4305001:Robo4 UTSW 9 37,322,687 (GRCm39) missense probably damaging 1.00
R0056:Robo4 UTSW 9 37,315,773 (GRCm39) missense probably benign 0.03
R0068:Robo4 UTSW 9 37,315,773 (GRCm39) missense probably benign 0.03
R0233:Robo4 UTSW 9 37,313,977 (GRCm39) missense probably damaging 1.00
R0233:Robo4 UTSW 9 37,313,977 (GRCm39) missense probably damaging 1.00
R0416:Robo4 UTSW 9 37,316,062 (GRCm39) splice site probably benign
R1005:Robo4 UTSW 9 37,319,547 (GRCm39) missense probably damaging 1.00
R1174:Robo4 UTSW 9 37,324,348 (GRCm39) missense probably damaging 1.00
R1183:Robo4 UTSW 9 37,319,348 (GRCm39) missense probably damaging 1.00
R1254:Robo4 UTSW 9 37,322,136 (GRCm39) critical splice donor site probably null
R1505:Robo4 UTSW 9 37,314,523 (GRCm39) missense probably damaging 0.98
R1701:Robo4 UTSW 9 37,314,739 (GRCm39) missense probably benign 0.44
R1834:Robo4 UTSW 9 37,324,355 (GRCm39) missense probably benign 0.09
R1899:Robo4 UTSW 9 37,315,366 (GRCm39) splice site probably benign
R2203:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2204:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2351:Robo4 UTSW 9 37,322,956 (GRCm39) missense probably benign 0.01
R2448:Robo4 UTSW 9 37,313,958 (GRCm39) missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37,315,772 (GRCm39) nonsense probably null
R2851:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2852:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R2877:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3123:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3124:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3125:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3805:Robo4 UTSW 9 37,315,734 (GRCm39) missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37,315,734 (GRCm39) missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R3905:Robo4 UTSW 9 37,314,801 (GRCm39) nonsense probably null
R3938:Robo4 UTSW 9 37,313,313 (GRCm39) start gained probably benign
R4261:Robo4 UTSW 9 37,316,877 (GRCm39) missense probably benign 0.04
R4434:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4435:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4561:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4562:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R4568:Robo4 UTSW 9 37,316,118 (GRCm39) missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37,314,495 (GRCm39) missense probably damaging 1.00
R4921:Robo4 UTSW 9 37,313,856 (GRCm39) missense probably benign
R5000:Robo4 UTSW 9 37,319,664 (GRCm39) missense probably benign 0.02
R5056:Robo4 UTSW 9 37,316,102 (GRCm39) missense probably benign 0.00
R5125:Robo4 UTSW 9 37,319,256 (GRCm39) missense probably damaging 1.00
R5178:Robo4 UTSW 9 37,319,256 (GRCm39) missense probably damaging 1.00
R5278:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5279:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5285:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5347:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5348:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5361:Robo4 UTSW 9 37,324,674 (GRCm39) missense probably benign 0.01
R5403:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5404:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5488:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5489:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5490:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5494:Robo4 UTSW 9 37,322,786 (GRCm39) frame shift probably null
R5629:Robo4 UTSW 9 37,319,658 (GRCm39) missense probably damaging 1.00
R5736:Robo4 UTSW 9 37,316,093 (GRCm39) missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37,322,970 (GRCm39) missense probably benign 0.00
R5987:Robo4 UTSW 9 37,322,696 (GRCm39) missense probably damaging 1.00
R6178:Robo4 UTSW 9 37,316,926 (GRCm39) nonsense probably null
R6189:Robo4 UTSW 9 37,314,829 (GRCm39) missense probably benign 0.35
R6365:Robo4 UTSW 9 37,322,008 (GRCm39) missense probably benign 0.34
R6528:Robo4 UTSW 9 37,315,664 (GRCm39) missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37,313,363 (GRCm39) missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37,314,001 (GRCm39) missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37,322,277 (GRCm39) missense probably benign 0.09
R7419:Robo4 UTSW 9 37,314,105 (GRCm39) missense probably benign 0.18
R7486:Robo4 UTSW 9 37,316,870 (GRCm39) missense probably damaging 0.99
R7707:Robo4 UTSW 9 37,324,418 (GRCm39) missense probably damaging 1.00
R7839:Robo4 UTSW 9 37,322,055 (GRCm39) missense probably damaging 1.00
R8079:Robo4 UTSW 9 37,313,931 (GRCm39) missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37,316,936 (GRCm39) missense probably damaging 0.99
R8280:Robo4 UTSW 9 37,315,372 (GRCm39) missense probably benign 0.00
R8526:Robo4 UTSW 9 37,314,801 (GRCm39) nonsense probably null
R8547:Robo4 UTSW 9 37,315,674 (GRCm39) missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37,319,577 (GRCm39) missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37,317,130 (GRCm39) missense unknown
R8889:Robo4 UTSW 9 37,314,601 (GRCm39) missense probably benign 0.00
R9018:Robo4 UTSW 9 37,315,520 (GRCm39) missense probably benign 0.00
R9182:Robo4 UTSW 9 37,313,206 (GRCm39) start gained probably benign
R9375:Robo4 UTSW 9 37,316,158 (GRCm39) missense probably damaging 1.00
R9621:Robo4 UTSW 9 37,317,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTACCTGTAACAGTCGCTCC -3'
(R):5'- AGCCGTAAAACGTGCTCGTGTC -3'

Sequencing Primer
(F):5'- TCAGAGCTGCACGTCTTGAC -3'
(R):5'- AACGTGCTCGTGTCTGGAAG -3'
Posted On 2014-03-14