Mutagenetix > Incidental Mutation

Incidental Mutation 'R1398:Rev3l'

160244

Institutional Source

Beutler Lab

Gene Symbol

Rev3l

Ensembl Gene

ENSMUSG00000019841

Gene Name

REV3 like, DNA directed polymerase zeta catalytic subunit

Synonyms

Sez4, Rev

MMRRC Submission

039460-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39732118-39875211 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 39821583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 692 (V692E)

Ref Sequence

ENSEMBL: ENSMUSP00000131519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000019986
AA Change: V692E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: V692E

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	201	1.6e-10	PFAM
low complexity region	494	506	N/A	INTRINSIC
low complexity region	959	969	N/A	INTRINSIC
low complexity region	1042	1057	N/A	INTRINSIC
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3103	8.2e-16	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131186

Predicted Effect

probably benign
Transcript: ENSMUST00000139803

SMART Domains

Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

Domain	Start	End	E-Value	Type
Blast:POLBc	1	369	1e-155	BLAST
POLBc	434	805	4.77e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164763
AA Change: V692E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: V692E

Domain	Start	End	E-Value	Type
Pfam:DNA_pol_B_exo1	43	200	1.3e-11	PFAM
low complexity region	494	506	N/A	INTRINSIC
Pfam:DUF4683	745	1132	1.7e-162	PFAM
low complexity region	1205	1216	N/A	INTRINSIC
low complexity region	1424	1440	N/A	INTRINSIC
low complexity region	1569	1595	N/A	INTRINSIC
Blast:POLBc	1825	2243	1e-163	BLAST
PDB:4GK5\|D	1863	1895	4e-13	PDB
POLBc	2308	2783	5.32e-105	SMART
Blast:POLBc	2860	2926	2e-14	BLAST
Pfam:zf-C4pol	3034	3102	6.1e-15	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,341	Q253K	possibly damaging	Het
9330182L06Rik	A	G	5: 9,380,297	Y69C	probably damaging	Het
Abca17	T	C	17: 24,328,537	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,256,736		probably null	Het
Anks1b	A	G	10: 90,050,029	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,295,296		probably benign	Het
C4b	T	A	17: 34,730,719		probably benign	Het
Cacna2d1	G	A	5: 16,357,766	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,781,971		probably benign	Het
Cep63	A	T	9: 102,603,086		probably benign	Het
Chil4	T	A	3: 106,219,509		probably null	Het
Cnot11	A	G	1: 39,545,180	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,638,625	S254P	probably damaging	Het
Dnah11	T	A	12: 118,057,106	K87*	probably null	Het
Dpy19l2	T	A	9: 24,581,263		probably benign	Het
Dsc1	A	T	18: 20,088,336	I694N	probably damaging	Het
Ehd4	A	T	2: 120,127,600	I168K	probably benign	Het
Eif4e	A	T	3: 138,546,375	N25Y	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam160b1	T	A	19: 57,372,926		probably benign	Het
Fgfrl1	T	A	5: 108,706,281		probably benign	Het
Gm3159	T	A	14: 4,398,586	Y92*	probably null	Het
Gm4922	T	A	10: 18,783,748	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,714,262		probably benign	Het
Grsf1	A	G	5: 88,665,847	Y231H	probably benign	Het
Heatr4	T	A	12: 83,967,621	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Isg20l2	C	A	3: 87,938,754	L325I	probably benign	Het
Kalrn	A	G	16: 34,212,820	Y879H	probably damaging	Het
Kcnk10	C	A	12: 98,436,226	W318L	probably damaging	Het
Kctd1	T	C	18: 15,062,597	E323G	possibly damaging	Het
Kif4	G	T	X: 100,689,097	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,627,732	T151A	unknown	Het
Ldlr	A	T	9: 21,739,542	Q449L	probably benign	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lgals12	C	T	19: 7,603,957		probably benign	Het
Lrig3	C	T	10: 126,003,088	P488L	probably benign	Het
Lrrc4b	A	C	7: 44,462,452	I583L	probably benign	Het
Lyst	T	C	13: 13,740,536	S3272P	possibly damaging	Het
March2	T	C	17: 33,696,122	H166R	probably damaging	Het
Mtbp	C	A	15: 55,577,537	Y373*	probably null	Het
Myh2	C	T	11: 67,185,287	H767Y	probably benign	Het
Ncam1	G	A	9: 49,517,589		probably benign	Het
Neb	T	A	2: 52,289,646	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,448,756	Y428H	possibly damaging	Het
Nrros	A	T	16: 32,143,144	I649N	probably damaging	Het
Nvl	A	T	1: 181,097,126		probably benign	Het
Olfr495	T	A	7: 108,395,501	V127E	probably damaging	Het
Pms1	A	T	1: 53,207,276	V368E	possibly damaging	Het
Polq	T	A	16: 37,062,495	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,542,879	V31A	probably damaging	Het
Robo4	T	C	9: 37,408,076		probably null	Het
Rps6kc1	T	C	1: 190,800,015	I597V	probably damaging	Het
Rtel1	T	A	2: 181,335,865		probably null	Het
Scn9a	A	G	2: 66,484,586	M1587T	probably benign	Het
Sec31b	T	A	19: 44,523,665	I597F	probably benign	Het
Skint5	T	C	4: 113,779,071	N650S	unknown	Het
Slc22a28	G	T	19: 8,130,202	S167*	probably null	Het
Slfn1	T	A	11: 83,121,142	M28K	probably damaging	Het
Smc6	T	C	12: 11,271,879		probably benign	Het
Sox8	T	C	17: 25,567,883	H282R	probably benign	Het
Syngr3	C	A	17: 24,686,440	V161L	probably benign	Het
Trak1	C	T	9: 121,454,359	S397F	probably damaging	Het
Uso1	C	T	5: 92,181,468	A405V	probably benign	Het
Uvrag	G	T	7: 99,065,820	Y190*	probably null	Het
Vps13d	A	T	4: 145,099,983	L1726Q	probably null	Het
Vwf	A	T	6: 125,603,457	Q556L	probably benign	Het
Wdr70	T	A	15: 8,035,844	M246L	probably benign	Het
Yipf3	T	C	17: 46,251,446	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,826,873	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,627,297	F125L	probably benign	Het

Other mutations in Rev3l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Rev3l	APN	10	39806969	missense	probably benign
IGL00815:Rev3l	APN	10	39859153	missense	possibly damaging	0.79
IGL00964:Rev3l	APN	10	39864806	missense	probably benign	0.39
IGL01765:Rev3l	APN	10	39828265	missense	probably benign	0.00
IGL01792:Rev3l	APN	10	39823340	missense	probably benign
IGL01950:Rev3l	APN	10	39821157	missense	probably damaging	1.00
IGL01963:Rev3l	APN	10	39822737	missense	possibly damaging	0.90
IGL02089:Rev3l	APN	10	39825099	missense	probably damaging	1.00
IGL02288:Rev3l	APN	10	39828216	missense	probably benign
IGL02381:Rev3l	APN	10	39821346	missense	possibly damaging	0.83
IGL02409:Rev3l	APN	10	39821148	missense	possibly damaging	0.75
IGL02434:Rev3l	APN	10	39822591	missense	probably damaging	1.00
IGL02570:Rev3l	APN	10	39848013	missense	possibly damaging	0.68
IGL02581:Rev3l	APN	10	39821281	missense	probably benign	0.10
IGL02654:Rev3l	APN	10	39862734	missense	probably damaging	1.00
IGL02720:Rev3l	APN	10	39822395	nonsense	probably null
IGL02746:Rev3l	APN	10	39824589	missense	probably damaging	0.99
IGL02829:Rev3l	APN	10	39825240	missense	probably damaging	1.00
IGL02961:Rev3l	APN	10	39827945	missense	possibly damaging	0.65
IGL02974:Rev3l	APN	10	39862747	nonsense	probably null
IGL03029:Rev3l	APN	10	39828486	missense	probably benign	0.34
IGL03153:Rev3l	APN	10	39806878	missense	probably damaging	1.00
IGL03172:Rev3l	APN	10	39824790	missense	probably benign	0.10
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0068:Rev3l	UTSW	10	39824831	missense	possibly damaging	0.68
R0153:Rev3l	UTSW	10	39874128	nonsense	probably null
R0308:Rev3l	UTSW	10	39824894	missense	probably benign	0.09
R0355:Rev3l	UTSW	10	39817286	missense	probably damaging	1.00
R0513:Rev3l	UTSW	10	39828143	missense	probably benign	0.00
R0523:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R0559:Rev3l	UTSW	10	39824487	missense	probably damaging	1.00
R0761:Rev3l	UTSW	10	39874195	missense	probably benign	0.32
R1023:Rev3l	UTSW	10	39832639	missense	probably damaging	1.00
R1159:Rev3l	UTSW	10	39851925	nonsense	probably null
R1478:Rev3l	UTSW	10	39783333	critical splice donor site	probably null
R1517:Rev3l	UTSW	10	39838443	missense	probably benign	0.34
R1527:Rev3l	UTSW	10	39822822	missense	probably damaging	1.00
R1635:Rev3l	UTSW	10	39806662	missense	probably damaging	0.98
R1695:Rev3l	UTSW	10	39824615	nonsense	probably null
R1695:Rev3l	UTSW	10	39824616	missense	probably damaging	0.97
R1782:Rev3l	UTSW	10	39799885	missense	probably benign
R1815:Rev3l	UTSW	10	39822871	missense	probably benign	0.41
R1818:Rev3l	UTSW	10	39828424	missense	probably benign	0.05
R2039:Rev3l	UTSW	10	39824444	missense	probably damaging	1.00
R2071:Rev3l	UTSW	10	39824353	missense	probably benign	0.17
R2101:Rev3l	UTSW	10	39828096	missense	probably benign	0.00
R2141:Rev3l	UTSW	10	39848049	missense	probably benign	0.02
R2883:Rev3l	UTSW	10	39825156	missense	probably damaging	1.00
R3787:Rev3l	UTSW	10	39846210	missense	probably damaging	0.97
R3910:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3912:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R3913:Rev3l	UTSW	10	39820556	missense	probably damaging	1.00
R4590:Rev3l	UTSW	10	39806933	missense	probably damaging	1.00
R4631:Rev3l	UTSW	10	39828416	missense	probably benign	0.44
R4633:Rev3l	UTSW	10	39846186	missense	probably damaging	1.00
R4707:Rev3l	UTSW	10	39823397	missense	probably damaging	0.99
R4724:Rev3l	UTSW	10	39846806	nonsense	probably null
R4810:Rev3l	UTSW	10	39823725	missense	probably benign	0.01
R4857:Rev3l	UTSW	10	39838459	missense	probably damaging	1.00
R4882:Rev3l	UTSW	10	39821460	missense	possibly damaging	0.89
R4928:Rev3l	UTSW	10	39823985	missense	probably benign	0.30
R4970:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R4977:Rev3l	UTSW	10	39823578	missense	possibly damaging	0.80
R5112:Rev3l	UTSW	10	39823330	missense	probably benign	0.00
R5261:Rev3l	UTSW	10	39846729	missense	probably damaging	1.00
R5419:Rev3l	UTSW	10	39824931	missense	possibly damaging	0.95
R5570:Rev3l	UTSW	10	39852075	critical splice donor site	probably null
R5628:Rev3l	UTSW	10	39822967	missense	probably damaging	0.98
R5689:Rev3l	UTSW	10	39794958	missense	probably damaging	1.00
R5781:Rev3l	UTSW	10	39823093	missense	probably benign	0.00
R5829:Rev3l	UTSW	10	39806906	missense	probably damaging	0.97
R5984:Rev3l	UTSW	10	39742689	intron	probably benign
R5990:Rev3l	UTSW	10	39823811	missense	probably benign	0.17
R6054:Rev3l	UTSW	10	39824150	missense	probably benign	0.01
R6171:Rev3l	UTSW	10	39862713	nonsense	probably null
R6220:Rev3l	UTSW	10	39822779	missense	probably damaging	1.00
R6520:Rev3l	UTSW	10	39822702	missense	probably benign	0.06
R6798:Rev3l	UTSW	10	39854763	missense	probably damaging	1.00
R6811:Rev3l	UTSW	10	39830921	nonsense	probably null
R6812:Rev3l	UTSW	10	39823548	missense	probably benign
R6904:Rev3l	UTSW	10	39821481	missense	probably benign
R6905:Rev3l	UTSW	10	39817327	missense	probably benign	0.18
R6938:Rev3l	UTSW	10	39862710	missense	probably damaging	1.00
R7037:Rev3l	UTSW	10	39851975	missense	probably damaging	1.00
R7124:Rev3l	UTSW	10	39822167	nonsense	probably null
R7286:Rev3l	UTSW	10	39823605	missense	probably damaging	0.99
R7385:Rev3l	UTSW	10	39823682	missense	probably benign	0.01
R7575:Rev3l	UTSW	10	39821445	missense	possibly damaging	0.56
R7596:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R7597:Rev3l	UTSW	10	39822884	missense	probably damaging	1.00
R7670:Rev3l	UTSW	10	39836722	missense	probably benign	0.01
R7804:Rev3l	UTSW	10	39823485	missense	probably benign	0.34
R7818:Rev3l	UTSW	10	39823902	missense	possibly damaging	0.54
R7874:Rev3l	UTSW	10	39822495	missense	possibly damaging	0.72
R7991:Rev3l	UTSW	10	39863738	missense	possibly damaging	0.52
R8059:Rev3l	UTSW	10	39843495	missense	probably damaging	1.00
R8174:Rev3l	UTSW	10	39859115	missense	probably damaging	1.00
R8187:Rev3l	UTSW	10	39806697	missense	probably benign
R8299:Rev3l	UTSW	10	39821541	missense	probably benign	0.01
R8352:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8452:Rev3l	UTSW	10	39822903	missense	probably damaging	1.00
R8468:Rev3l	UTSW	10	39827991	missense	probably damaging	0.99
R8487:Rev3l	UTSW	10	39806848	missense	probably damaging	1.00
R8512:Rev3l	UTSW	10	39821538	missense	probably damaging	1.00
R8554:Rev3l	UTSW	10	39806842	missense	probably benign	0.12
R8702:Rev3l	UTSW	10	39838469	nonsense	probably null
R8848:Rev3l	UTSW	10	39846709	missense	probably damaging	0.99
R8857:Rev3l	UTSW	10	39794969	nonsense	probably null
R8870:Rev3l	UTSW	10	39862790	missense	probably damaging	1.00
R9094:Rev3l	UTSW	10	39824813	missense	probably benign
R9175:Rev3l	UTSW	10	39854768	missense	possibly damaging	0.83
R9286:Rev3l	UTSW	10	39806951	missense	possibly damaging	0.54
R9299:Rev3l	UTSW	10	39848003	missense	probably damaging	1.00
R9307:Rev3l	UTSW	10	39817153	missense	probably benign	0.01
R9337:Rev3l	UTSW	10	39822854	missense	probably benign	0.40
R9342:Rev3l	UTSW	10	39821462	missense	probably benign
R9389:Rev3l	UTSW	10	39822971	missense	possibly damaging	0.47
R9395:Rev3l	UTSW	10	39859223	critical splice donor site	probably null
R9458:Rev3l	UTSW	10	39783251	missense	probably damaging	1.00
R9481:Rev3l	UTSW	10	39825037	missense	probably benign
R9646:Rev3l	UTSW	10	39822444	missense	probably damaging	1.00
R9686:Rev3l	UTSW	10	39867388	missense	possibly damaging	0.67
X0022:Rev3l	UTSW	10	39828607	critical splice donor site	probably null
Z1088:Rev3l	UTSW	10	39824318	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- GTGATTGCAACGAGCAAGCTATCAG -3'
(R):5'- ACGGCAGCAAGTCACAGTTTTCC -3'

Sequencing Primer
(F):5'- GTACTTACTCCATGAAGTACTCTGG -3'
(R):5'- CAGCAAGTCACAGTTTTCCGTTAG -3'

Posted On

2014-03-14