Incidental Mutation 'R1398:Rev3l'
ID 160244
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene Name REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms Sez4, Rev
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1398 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 39608114-39751207 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39697579 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 692 (V692E)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: V692E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: V692E

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: V692E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: V692E

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39,682,965 (GRCm39) missense probably benign
IGL00815:Rev3l APN 10 39,735,149 (GRCm39) missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39,740,802 (GRCm39) missense probably benign 0.39
IGL01765:Rev3l APN 10 39,704,261 (GRCm39) missense probably benign 0.00
IGL01792:Rev3l APN 10 39,699,336 (GRCm39) missense probably benign
IGL01950:Rev3l APN 10 39,697,153 (GRCm39) missense probably damaging 1.00
IGL01963:Rev3l APN 10 39,698,733 (GRCm39) missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39,701,095 (GRCm39) missense probably damaging 1.00
IGL02288:Rev3l APN 10 39,704,212 (GRCm39) missense probably benign
IGL02381:Rev3l APN 10 39,697,342 (GRCm39) missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39,697,144 (GRCm39) missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39,698,587 (GRCm39) missense probably damaging 1.00
IGL02570:Rev3l APN 10 39,724,009 (GRCm39) missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39,697,277 (GRCm39) missense probably benign 0.10
IGL02654:Rev3l APN 10 39,738,730 (GRCm39) missense probably damaging 1.00
IGL02720:Rev3l APN 10 39,698,391 (GRCm39) nonsense probably null
IGL02746:Rev3l APN 10 39,700,585 (GRCm39) missense probably damaging 0.99
IGL02829:Rev3l APN 10 39,701,236 (GRCm39) missense probably damaging 1.00
IGL02961:Rev3l APN 10 39,703,941 (GRCm39) missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39,738,743 (GRCm39) nonsense probably null
IGL03029:Rev3l APN 10 39,704,482 (GRCm39) missense probably benign 0.34
IGL03153:Rev3l APN 10 39,682,874 (GRCm39) missense probably damaging 1.00
IGL03172:Rev3l APN 10 39,700,786 (GRCm39) missense probably benign 0.10
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39,700,827 (GRCm39) missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39,750,124 (GRCm39) nonsense probably null
R0308:Rev3l UTSW 10 39,700,890 (GRCm39) missense probably benign 0.09
R0355:Rev3l UTSW 10 39,693,282 (GRCm39) missense probably damaging 1.00
R0513:Rev3l UTSW 10 39,704,139 (GRCm39) missense probably benign 0.00
R0523:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R0559:Rev3l UTSW 10 39,700,483 (GRCm39) missense probably damaging 1.00
R0761:Rev3l UTSW 10 39,750,191 (GRCm39) missense probably benign 0.32
R1023:Rev3l UTSW 10 39,708,635 (GRCm39) missense probably damaging 1.00
R1159:Rev3l UTSW 10 39,727,921 (GRCm39) nonsense probably null
R1478:Rev3l UTSW 10 39,659,329 (GRCm39) critical splice donor site probably null
R1517:Rev3l UTSW 10 39,714,439 (GRCm39) missense probably benign 0.34
R1527:Rev3l UTSW 10 39,698,818 (GRCm39) missense probably damaging 1.00
R1635:Rev3l UTSW 10 39,682,658 (GRCm39) missense probably damaging 0.98
R1695:Rev3l UTSW 10 39,700,612 (GRCm39) missense probably damaging 0.97
R1695:Rev3l UTSW 10 39,700,611 (GRCm39) nonsense probably null
R1782:Rev3l UTSW 10 39,675,881 (GRCm39) missense probably benign
R1815:Rev3l UTSW 10 39,698,867 (GRCm39) missense probably benign 0.41
R1818:Rev3l UTSW 10 39,704,420 (GRCm39) missense probably benign 0.05
R2039:Rev3l UTSW 10 39,700,440 (GRCm39) missense probably damaging 1.00
R2071:Rev3l UTSW 10 39,700,349 (GRCm39) missense probably benign 0.17
R2101:Rev3l UTSW 10 39,704,092 (GRCm39) missense probably benign 0.00
R2141:Rev3l UTSW 10 39,724,045 (GRCm39) missense probably benign 0.02
R2883:Rev3l UTSW 10 39,701,152 (GRCm39) missense probably damaging 1.00
R3787:Rev3l UTSW 10 39,722,206 (GRCm39) missense probably damaging 0.97
R3910:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3912:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R3913:Rev3l UTSW 10 39,696,552 (GRCm39) missense probably damaging 1.00
R4590:Rev3l UTSW 10 39,682,929 (GRCm39) missense probably damaging 1.00
R4631:Rev3l UTSW 10 39,704,412 (GRCm39) missense probably benign 0.44
R4633:Rev3l UTSW 10 39,722,182 (GRCm39) missense probably damaging 1.00
R4707:Rev3l UTSW 10 39,699,393 (GRCm39) missense probably damaging 0.99
R4724:Rev3l UTSW 10 39,722,802 (GRCm39) nonsense probably null
R4810:Rev3l UTSW 10 39,699,721 (GRCm39) missense probably benign 0.01
R4857:Rev3l UTSW 10 39,714,455 (GRCm39) missense probably damaging 1.00
R4882:Rev3l UTSW 10 39,697,456 (GRCm39) missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39,699,981 (GRCm39) missense probably benign 0.30
R4970:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R4977:Rev3l UTSW 10 39,699,574 (GRCm39) missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39,699,326 (GRCm39) missense probably benign 0.00
R5261:Rev3l UTSW 10 39,722,725 (GRCm39) missense probably damaging 1.00
R5419:Rev3l UTSW 10 39,700,927 (GRCm39) missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39,728,071 (GRCm39) critical splice donor site probably null
R5628:Rev3l UTSW 10 39,698,963 (GRCm39) missense probably damaging 0.98
R5689:Rev3l UTSW 10 39,670,954 (GRCm39) missense probably damaging 1.00
R5781:Rev3l UTSW 10 39,699,089 (GRCm39) missense probably benign 0.00
R5829:Rev3l UTSW 10 39,682,902 (GRCm39) missense probably damaging 0.97
R5984:Rev3l UTSW 10 39,618,685 (GRCm39) intron probably benign
R5990:Rev3l UTSW 10 39,699,807 (GRCm39) missense probably benign 0.17
R6054:Rev3l UTSW 10 39,700,146 (GRCm39) missense probably benign 0.01
R6171:Rev3l UTSW 10 39,738,709 (GRCm39) nonsense probably null
R6220:Rev3l UTSW 10 39,698,775 (GRCm39) missense probably damaging 1.00
R6520:Rev3l UTSW 10 39,698,698 (GRCm39) missense probably benign 0.06
R6798:Rev3l UTSW 10 39,730,759 (GRCm39) missense probably damaging 1.00
R6811:Rev3l UTSW 10 39,706,917 (GRCm39) nonsense probably null
R6812:Rev3l UTSW 10 39,699,544 (GRCm39) missense probably benign
R6904:Rev3l UTSW 10 39,697,477 (GRCm39) missense probably benign
R6905:Rev3l UTSW 10 39,693,323 (GRCm39) missense probably benign 0.18
R6938:Rev3l UTSW 10 39,738,706 (GRCm39) missense probably damaging 1.00
R7037:Rev3l UTSW 10 39,727,971 (GRCm39) missense probably damaging 1.00
R7124:Rev3l UTSW 10 39,698,163 (GRCm39) nonsense probably null
R7286:Rev3l UTSW 10 39,699,601 (GRCm39) missense probably damaging 0.99
R7385:Rev3l UTSW 10 39,699,678 (GRCm39) missense probably benign 0.01
R7575:Rev3l UTSW 10 39,697,441 (GRCm39) missense possibly damaging 0.56
R7596:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R7597:Rev3l UTSW 10 39,698,880 (GRCm39) missense probably damaging 1.00
R7670:Rev3l UTSW 10 39,712,718 (GRCm39) missense probably benign 0.01
R7804:Rev3l UTSW 10 39,699,481 (GRCm39) missense probably benign 0.34
R7818:Rev3l UTSW 10 39,699,898 (GRCm39) missense possibly damaging 0.54
R7874:Rev3l UTSW 10 39,698,491 (GRCm39) missense possibly damaging 0.72
R7991:Rev3l UTSW 10 39,739,734 (GRCm39) missense possibly damaging 0.52
R8059:Rev3l UTSW 10 39,719,491 (GRCm39) missense probably damaging 1.00
R8174:Rev3l UTSW 10 39,735,111 (GRCm39) missense probably damaging 1.00
R8187:Rev3l UTSW 10 39,682,693 (GRCm39) missense probably benign
R8299:Rev3l UTSW 10 39,697,537 (GRCm39) missense probably benign 0.01
R8352:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8452:Rev3l UTSW 10 39,698,899 (GRCm39) missense probably damaging 1.00
R8468:Rev3l UTSW 10 39,703,987 (GRCm39) missense probably damaging 0.99
R8487:Rev3l UTSW 10 39,682,844 (GRCm39) missense probably damaging 1.00
R8512:Rev3l UTSW 10 39,697,534 (GRCm39) missense probably damaging 1.00
R8554:Rev3l UTSW 10 39,682,838 (GRCm39) missense probably benign 0.12
R8702:Rev3l UTSW 10 39,714,465 (GRCm39) nonsense probably null
R8848:Rev3l UTSW 10 39,722,705 (GRCm39) missense probably damaging 0.99
R8857:Rev3l UTSW 10 39,670,965 (GRCm39) nonsense probably null
R8870:Rev3l UTSW 10 39,738,786 (GRCm39) missense probably damaging 1.00
R9094:Rev3l UTSW 10 39,700,809 (GRCm39) missense probably benign
R9175:Rev3l UTSW 10 39,730,764 (GRCm39) missense possibly damaging 0.83
R9286:Rev3l UTSW 10 39,682,947 (GRCm39) missense possibly damaging 0.54
R9299:Rev3l UTSW 10 39,723,999 (GRCm39) missense probably damaging 1.00
R9307:Rev3l UTSW 10 39,693,149 (GRCm39) missense probably benign 0.01
R9337:Rev3l UTSW 10 39,698,850 (GRCm39) missense probably benign 0.40
R9342:Rev3l UTSW 10 39,697,458 (GRCm39) missense probably benign
R9389:Rev3l UTSW 10 39,698,967 (GRCm39) missense possibly damaging 0.47
R9395:Rev3l UTSW 10 39,735,219 (GRCm39) critical splice donor site probably null
R9458:Rev3l UTSW 10 39,659,247 (GRCm39) missense probably damaging 1.00
R9481:Rev3l UTSW 10 39,701,033 (GRCm39) missense probably benign
R9646:Rev3l UTSW 10 39,698,440 (GRCm39) missense probably damaging 1.00
R9686:Rev3l UTSW 10 39,743,384 (GRCm39) missense possibly damaging 0.67
X0022:Rev3l UTSW 10 39,704,603 (GRCm39) critical splice donor site probably null
Z1088:Rev3l UTSW 10 39,700,314 (GRCm39) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GTGATTGCAACGAGCAAGCTATCAG -3'
(R):5'- ACGGCAGCAAGTCACAGTTTTCC -3'

Sequencing Primer
(F):5'- GTACTTACTCCATGAAGTACTCTGG -3'
(R):5'- CAGCAAGTCACAGTTTTCCGTTAG -3'
Posted On 2014-03-14