Incidental Mutation 'R1398:Rev3l'
ID160244
Institutional Source Beutler Lab
Gene Symbol Rev3l
Ensembl Gene ENSMUSG00000019841
Gene NameREV3 like, DNA directed polymerase zeta catalytic subunit
SynonymsSez4, Rev
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39732118-39875211 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 39821583 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 692 (V692E)
Ref Sequence ENSEMBL: ENSMUSP00000131519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019986] [ENSMUST00000131186] [ENSMUST00000139803] [ENSMUST00000164763]
Predicted Effect probably benign
Transcript: ENSMUST00000019986
AA Change: V692E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000019986
Gene: ENSMUSG00000019841
AA Change: V692E

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 201 1.6e-10 PFAM
low complexity region 494 506 N/A INTRINSIC
low complexity region 959 969 N/A INTRINSIC
low complexity region 1042 1057 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3103 8.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131186
Predicted Effect probably benign
Transcript: ENSMUST00000139803
SMART Domains Protein: ENSMUSP00000115630
Gene: ENSMUSG00000019841

DomainStartEndE-ValueType
Blast:POLBc 1 369 1e-155 BLAST
POLBc 434 805 4.77e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164763
AA Change: V692E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131519
Gene: ENSMUSG00000019841
AA Change: V692E

DomainStartEndE-ValueType
Pfam:DNA_pol_B_exo1 43 200 1.3e-11 PFAM
low complexity region 494 506 N/A INTRINSIC
Pfam:DUF4683 745 1132 1.7e-162 PFAM
low complexity region 1205 1216 N/A INTRINSIC
low complexity region 1424 1440 N/A INTRINSIC
low complexity region 1569 1595 N/A INTRINSIC
Blast:POLBc 1825 2243 1e-163 BLAST
PDB:4GK5|D 1863 1895 4e-13 PDB
POLBc 2308 2783 5.32e-105 SMART
Blast:POLBc 2860 2926 2e-14 BLAST
Pfam:zf-C4pol 3034 3102 6.1e-15 PFAM
Meta Mutation Damage Score 0.1588 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene represents the catalytic subunit of DNA polymerase zeta, which functions in translesion DNA synthesis. The encoded protein can be found in mitochondria, where it protects DNA from damage. Defects in this gene are a cause of Mobius syndrome. [provided by RefSeq, Jan 2017]
PHENOTYPE: Nullizygous mice exhibit complete embryonic lethality and abnormal embryonic tissue morphology with widespread degeneration and cell death. Mice carrying the amino acid substitution of phenylalanine for leucine at position 2610 display alterations in somatic hypermutation frequency and specificity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Rev3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Rev3l APN 10 39806969 missense probably benign
IGL00815:Rev3l APN 10 39859153 missense possibly damaging 0.79
IGL00964:Rev3l APN 10 39864806 missense probably benign 0.39
IGL01765:Rev3l APN 10 39828265 missense probably benign 0.00
IGL01792:Rev3l APN 10 39823340 missense probably benign
IGL01950:Rev3l APN 10 39821157 missense probably damaging 1.00
IGL01963:Rev3l APN 10 39822737 missense possibly damaging 0.90
IGL02089:Rev3l APN 10 39825099 missense probably damaging 1.00
IGL02288:Rev3l APN 10 39828216 missense probably benign
IGL02381:Rev3l APN 10 39821346 missense possibly damaging 0.83
IGL02409:Rev3l APN 10 39821148 missense possibly damaging 0.75
IGL02434:Rev3l APN 10 39822591 missense probably damaging 1.00
IGL02570:Rev3l APN 10 39848013 missense possibly damaging 0.68
IGL02581:Rev3l APN 10 39821281 missense probably benign 0.10
IGL02654:Rev3l APN 10 39862734 missense probably damaging 1.00
IGL02720:Rev3l APN 10 39822395 nonsense probably null
IGL02746:Rev3l APN 10 39824589 missense probably damaging 0.99
IGL02829:Rev3l APN 10 39825240 missense probably damaging 1.00
IGL02961:Rev3l APN 10 39827945 missense possibly damaging 0.65
IGL02974:Rev3l APN 10 39862747 nonsense probably null
IGL03029:Rev3l APN 10 39828486 missense probably benign 0.34
IGL03153:Rev3l APN 10 39806878 missense probably damaging 1.00
IGL03172:Rev3l APN 10 39824790 missense probably benign 0.10
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0068:Rev3l UTSW 10 39824831 missense possibly damaging 0.68
R0153:Rev3l UTSW 10 39874128 nonsense probably null
R0308:Rev3l UTSW 10 39824894 missense probably benign 0.09
R0355:Rev3l UTSW 10 39817286 missense probably damaging 1.00
R0513:Rev3l UTSW 10 39828143 missense probably benign 0.00
R0523:Rev3l UTSW 10 39848049 missense probably benign 0.02
R0559:Rev3l UTSW 10 39824487 missense probably damaging 1.00
R0761:Rev3l UTSW 10 39874195 missense probably benign 0.32
R1023:Rev3l UTSW 10 39832639 missense probably damaging 1.00
R1159:Rev3l UTSW 10 39851925 nonsense probably null
R1478:Rev3l UTSW 10 39783333 critical splice donor site probably null
R1517:Rev3l UTSW 10 39838443 missense probably benign 0.34
R1527:Rev3l UTSW 10 39822822 missense probably damaging 1.00
R1635:Rev3l UTSW 10 39806662 missense probably damaging 0.98
R1695:Rev3l UTSW 10 39824615 nonsense probably null
R1695:Rev3l UTSW 10 39824616 missense probably damaging 0.97
R1782:Rev3l UTSW 10 39799885 missense probably benign
R1815:Rev3l UTSW 10 39822871 missense probably benign 0.41
R1818:Rev3l UTSW 10 39828424 missense probably benign 0.05
R2039:Rev3l UTSW 10 39824444 missense probably damaging 1.00
R2071:Rev3l UTSW 10 39824353 missense probably benign 0.17
R2101:Rev3l UTSW 10 39828096 missense probably benign 0.00
R2141:Rev3l UTSW 10 39848049 missense probably benign 0.02
R2883:Rev3l UTSW 10 39825156 missense probably damaging 1.00
R3787:Rev3l UTSW 10 39846210 missense probably damaging 0.97
R3910:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3912:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R3913:Rev3l UTSW 10 39820556 missense probably damaging 1.00
R4590:Rev3l UTSW 10 39806933 missense probably damaging 1.00
R4631:Rev3l UTSW 10 39828416 missense probably benign 0.44
R4633:Rev3l UTSW 10 39846186 missense probably damaging 1.00
R4707:Rev3l UTSW 10 39823397 missense probably damaging 0.99
R4724:Rev3l UTSW 10 39846806 nonsense probably null
R4810:Rev3l UTSW 10 39823725 missense probably benign 0.01
R4857:Rev3l UTSW 10 39838459 missense probably damaging 1.00
R4882:Rev3l UTSW 10 39821460 missense possibly damaging 0.89
R4928:Rev3l UTSW 10 39823985 missense probably benign 0.30
R4970:Rev3l UTSW 10 39823330 missense probably benign 0.00
R4977:Rev3l UTSW 10 39823578 missense possibly damaging 0.80
R5112:Rev3l UTSW 10 39823330 missense probably benign 0.00
R5261:Rev3l UTSW 10 39846729 missense probably damaging 1.00
R5419:Rev3l UTSW 10 39824931 missense possibly damaging 0.95
R5570:Rev3l UTSW 10 39852075 critical splice donor site probably null
R5628:Rev3l UTSW 10 39822967 missense probably damaging 0.98
R5689:Rev3l UTSW 10 39794958 missense probably damaging 1.00
R5781:Rev3l UTSW 10 39823093 missense probably benign 0.00
R5829:Rev3l UTSW 10 39806906 missense probably damaging 0.97
R5984:Rev3l UTSW 10 39742689 intron probably benign
R5990:Rev3l UTSW 10 39823811 missense probably benign 0.17
R6054:Rev3l UTSW 10 39824150 missense probably benign 0.01
R6171:Rev3l UTSW 10 39862713 nonsense probably null
R6220:Rev3l UTSW 10 39822779 missense probably damaging 1.00
R6520:Rev3l UTSW 10 39822702 missense probably benign 0.06
R6798:Rev3l UTSW 10 39854763 missense probably damaging 1.00
R6811:Rev3l UTSW 10 39830921 nonsense probably null
R6812:Rev3l UTSW 10 39823548 missense probably benign
R6904:Rev3l UTSW 10 39821481 missense probably benign
R6905:Rev3l UTSW 10 39817327 missense probably benign 0.18
R6938:Rev3l UTSW 10 39862710 missense probably damaging 1.00
R7037:Rev3l UTSW 10 39851975 missense probably damaging 1.00
R7124:Rev3l UTSW 10 39822167 nonsense probably null
R7286:Rev3l UTSW 10 39823605 missense probably damaging 0.99
R7385:Rev3l UTSW 10 39823682 missense probably benign 0.01
X0022:Rev3l UTSW 10 39828607 critical splice donor site probably null
Z1088:Rev3l UTSW 10 39824318 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- GTGATTGCAACGAGCAAGCTATCAG -3'
(R):5'- ACGGCAGCAAGTCACAGTTTTCC -3'

Sequencing Primer
(F):5'- GTACTTACTCCATGAAGTACTCTGG -3'
(R):5'- CAGCAAGTCACAGTTTTCCGTTAG -3'
Posted On2014-03-14