Incidental Mutation 'R1398:Lrig3'
ID 160246
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Name leucine-rich repeats and immunoglobulin-like domains 3
Synonyms 9430095K15Rik, 9030421L11Rik, 9130004I02Rik
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R1398 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 125802088-125851228 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 125838957 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 488 (P488L)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
AlphaFold Q6P1C6
PDB Structure Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000074807
AA Change: P488L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: P488L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Meta Mutation Damage Score 0.2670 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 125,849,017 (GRCm39) missense probably benign 0.00
IGL00426:Lrig3 APN 10 125,808,006 (GRCm39) nonsense probably null
IGL00969:Lrig3 APN 10 125,832,984 (GRCm39) missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125,830,335 (GRCm39) missense probably benign 0.01
IGL01510:Lrig3 APN 10 125,844,567 (GRCm39) missense probably damaging 1.00
IGL01825:Lrig3 APN 10 125,845,886 (GRCm39) missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125,833,041 (GRCm39) missense probably damaging 1.00
IGL02377:Lrig3 APN 10 125,850,743 (GRCm39) missense probably benign 0.00
IGL02648:Lrig3 APN 10 125,802,463 (GRCm39) missense probably benign
IGL02832:Lrig3 APN 10 125,842,871 (GRCm39) missense probably benign 0.37
IGL03266:Lrig3 APN 10 125,849,151 (GRCm39) missense probably benign 0.28
R0023:Lrig3 UTSW 10 125,846,088 (GRCm39) missense probably damaging 1.00
R0129:Lrig3 UTSW 10 125,842,812 (GRCm39) missense probably damaging 1.00
R0183:Lrig3 UTSW 10 125,846,061 (GRCm39) missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125,807,986 (GRCm39) splice site probably benign
R0233:Lrig3 UTSW 10 125,849,395 (GRCm39) splice site probably null
R0233:Lrig3 UTSW 10 125,849,395 (GRCm39) splice site probably null
R0336:Lrig3 UTSW 10 125,802,574 (GRCm39) missense probably benign 0.04
R0348:Lrig3 UTSW 10 125,849,317 (GRCm39) nonsense probably null
R0502:Lrig3 UTSW 10 125,844,605 (GRCm39) missense probably damaging 1.00
R0639:Lrig3 UTSW 10 125,846,090 (GRCm39) missense probably damaging 1.00
R1099:Lrig3 UTSW 10 125,842,883 (GRCm39) splice site probably null
R1220:Lrig3 UTSW 10 125,832,945 (GRCm39) missense probably damaging 1.00
R1230:Lrig3 UTSW 10 125,838,840 (GRCm39) missense probably damaging 1.00
R1451:Lrig3 UTSW 10 125,845,926 (GRCm39) missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 125,844,567 (GRCm39) missense probably damaging 1.00
R1545:Lrig3 UTSW 10 125,844,416 (GRCm39) missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125,833,570 (GRCm39) missense probably benign 0.12
R1665:Lrig3 UTSW 10 125,833,570 (GRCm39) missense probably benign 0.12
R1673:Lrig3 UTSW 10 125,846,036 (GRCm39) missense probably damaging 1.00
R1778:Lrig3 UTSW 10 125,845,944 (GRCm39) missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125,832,920 (GRCm39) splice site probably null
R1840:Lrig3 UTSW 10 125,849,258 (GRCm39) nonsense probably null
R1882:Lrig3 UTSW 10 125,845,694 (GRCm39) missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 125,838,262 (GRCm39) splice site probably benign
R2160:Lrig3 UTSW 10 125,833,565 (GRCm39) missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125,832,478 (GRCm39) splice site probably null
R2294:Lrig3 UTSW 10 125,802,363 (GRCm39) nonsense probably null
R2518:Lrig3 UTSW 10 125,830,310 (GRCm39) missense probably benign 0.07
R3037:Lrig3 UTSW 10 125,845,901 (GRCm39) missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125,833,056 (GRCm39) missense probably damaging 1.00
R4073:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4074:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4075:Lrig3 UTSW 10 125,849,277 (GRCm39) missense probably benign
R4077:Lrig3 UTSW 10 125,845,656 (GRCm39) missense probably damaging 1.00
R4079:Lrig3 UTSW 10 125,845,656 (GRCm39) missense probably damaging 1.00
R4405:Lrig3 UTSW 10 125,846,877 (GRCm39) missense probably benign 0.00
R4425:Lrig3 UTSW 10 125,849,273 (GRCm39) missense probably benign 0.00
R4505:Lrig3 UTSW 10 125,849,216 (GRCm39) missense probably benign 0.00
R4860:Lrig3 UTSW 10 125,846,921 (GRCm39) missense probably benign 0.36
R4860:Lrig3 UTSW 10 125,846,921 (GRCm39) missense probably benign 0.36
R4903:Lrig3 UTSW 10 125,832,482 (GRCm39) critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 125,849,020 (GRCm39) missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 125,842,559 (GRCm39) missense probably damaging 1.00
R5402:Lrig3 UTSW 10 125,844,609 (GRCm39) missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125,808,003 (GRCm39) missense probably damaging 1.00
R5792:Lrig3 UTSW 10 125,845,788 (GRCm39) missense probably damaging 1.00
R5903:Lrig3 UTSW 10 125,844,347 (GRCm39) missense probably damaging 1.00
R6280:Lrig3 UTSW 10 125,846,848 (GRCm39) missense probably benign 0.18
R6484:Lrig3 UTSW 10 125,832,478 (GRCm39) splice site probably null
R6985:Lrig3 UTSW 10 125,850,738 (GRCm39) missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125,832,993 (GRCm39) missense probably damaging 1.00
R7177:Lrig3 UTSW 10 125,842,712 (GRCm39) missense probably benign 0.02
R7347:Lrig3 UTSW 10 125,845,835 (GRCm39) missense probably damaging 1.00
R9093:Lrig3 UTSW 10 125,845,950 (GRCm39) missense possibly damaging 0.51
R9188:Lrig3 UTSW 10 125,838,935 (GRCm39) missense possibly damaging 0.80
R9295:Lrig3 UTSW 10 125,850,722 (GRCm39) missense probably benign 0.00
R9378:Lrig3 UTSW 10 125,832,953 (GRCm39) missense probably damaging 0.98
R9526:Lrig3 UTSW 10 125,850,736 (GRCm39) missense probably benign
R9567:Lrig3 UTSW 10 125,845,964 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACATCACACGTTCGGTTTCCTG -3'
(R):5'- TGTATGACATTTCCAGAAGCGGCAC -3'

Sequencing Primer
(F):5'- GGTTTGATTTACGTTTAGAAATCTGC -3'
(R):5'- CTGTAAAACTTTAACAAGCGGC -3'
Posted On 2014-03-14