Mutagenetix > Incidental Mutation

Incidental Mutation 'R1398:Lrig3'

160246

Institutional Source

Beutler Lab

Gene Symbol

Lrig3

Ensembl Gene

ENSMUSG00000020105

Gene Name

leucine-rich repeats and immunoglobulin-like domains 3

Synonyms

9030421L11Rik, 9430095K15Rik, 9130004I02Rik

MMRRC Submission

039460-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R1398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

125966168-126015359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 126003088 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 488 (P488L)

Ref Sequence

ENSEMBL: ENSMUSP00000074360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074807]

AlphaFold

Q6P1C6

PDB Structure

Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000074807
AA Change: P488L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: P488L

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
LRRNT	46	78	6.74e-2	SMART
LRR	72	96	4.45e1	SMART
LRR	97	120	1.06e1	SMART
LRR	144	166	1.14e0	SMART
LRR	168	189	1.62e2	SMART
LRR	190	214	1.09e1	SMART
LRR	215	237	1.71e1	SMART
LRR	238	261	2.29e0	SMART
LRR	262	285	3.07e-1	SMART
LRR	286	309	2.49e-1	SMART
LRR	310	333	1.29e1	SMART
LRR	334	357	6.22e0	SMART
LRR	358	384	6.05e0	SMART
LRR_TYP	385	408	1.56e-2	SMART
LRR_TYP	409	432	1.79e-2	SMART
LRRCT	444	494	2.35e-7	SMART
IGc2	511	588	1.65e-4	SMART
IGc2	615	683	1.33e-8	SMART
IGc2	709	774	2.78e-11	SMART
transmembrane domain	805	827	N/A	INTRINSIC
low complexity region	1069	1081	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220332

Meta Mutation Damage Score

0.2670

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,341	Q253K	possibly damaging	Het
9330182L06Rik	A	G	5: 9,380,297	Y69C	probably damaging	Het
Abca17	T	C	17: 24,328,537	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,256,736		probably null	Het
Anks1b	A	G	10: 90,050,029	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,295,296		probably benign	Het
C4b	T	A	17: 34,730,719		probably benign	Het
Cacna2d1	G	A	5: 16,357,766	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,781,971		probably benign	Het
Cep63	A	T	9: 102,603,086		probably benign	Het
Chil4	T	A	3: 106,219,509		probably null	Het
Cnot11	A	G	1: 39,545,180	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,638,625	S254P	probably damaging	Het
Dnah11	T	A	12: 118,057,106	K87*	probably null	Het
Dpy19l2	T	A	9: 24,581,263		probably benign	Het
Dsc1	A	T	18: 20,088,336	I694N	probably damaging	Het
Ehd4	A	T	2: 120,127,600	I168K	probably benign	Het
Eif4e	A	T	3: 138,546,375	N25Y	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam160b1	T	A	19: 57,372,926		probably benign	Het
Fgfrl1	T	A	5: 108,706,281		probably benign	Het
Gm3159	T	A	14: 4,398,586	Y92*	probably null	Het
Gm4922	T	A	10: 18,783,748	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,714,262		probably benign	Het
Grsf1	A	G	5: 88,665,847	Y231H	probably benign	Het
Heatr4	T	A	12: 83,967,621	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Isg20l2	C	A	3: 87,938,754	L325I	probably benign	Het
Kalrn	A	G	16: 34,212,820	Y879H	probably damaging	Het
Kcnk10	C	A	12: 98,436,226	W318L	probably damaging	Het
Kctd1	T	C	18: 15,062,597	E323G	possibly damaging	Het
Kif4	G	T	X: 100,689,097	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,627,732	T151A	unknown	Het
Ldlr	A	T	9: 21,739,542	Q449L	probably benign	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lgals12	C	T	19: 7,603,957		probably benign	Het
Lrrc4b	A	C	7: 44,462,452	I583L	probably benign	Het
Lyst	T	C	13: 13,740,536	S3272P	possibly damaging	Het
March2	T	C	17: 33,696,122	H166R	probably damaging	Het
Mtbp	C	A	15: 55,577,537	Y373*	probably null	Het
Myh2	C	T	11: 67,185,287	H767Y	probably benign	Het
Ncam1	G	A	9: 49,517,589		probably benign	Het
Neb	T	A	2: 52,289,646	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,448,756	Y428H	possibly damaging	Het
Nrros	A	T	16: 32,143,144	I649N	probably damaging	Het
Nvl	A	T	1: 181,097,126		probably benign	Het
Olfr495	T	A	7: 108,395,501	V127E	probably damaging	Het
Pms1	A	T	1: 53,207,276	V368E	possibly damaging	Het
Polq	T	A	16: 37,062,495	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,542,879	V31A	probably damaging	Het
Rev3l	T	A	10: 39,821,583	V692E	probably benign	Het
Robo4	T	C	9: 37,408,076		probably null	Het
Rps6kc1	T	C	1: 190,800,015	I597V	probably damaging	Het
Rtel1	T	A	2: 181,335,865		probably null	Het
Scn9a	A	G	2: 66,484,586	M1587T	probably benign	Het
Sec31b	T	A	19: 44,523,665	I597F	probably benign	Het
Skint5	T	C	4: 113,779,071	N650S	unknown	Het
Slc22a28	G	T	19: 8,130,202	S167*	probably null	Het
Slfn1	T	A	11: 83,121,142	M28K	probably damaging	Het
Smc6	T	C	12: 11,271,879		probably benign	Het
Sox8	T	C	17: 25,567,883	H282R	probably benign	Het
Syngr3	C	A	17: 24,686,440	V161L	probably benign	Het
Trak1	C	T	9: 121,454,359	S397F	probably damaging	Het
Uso1	C	T	5: 92,181,468	A405V	probably benign	Het
Uvrag	G	T	7: 99,065,820	Y190*	probably null	Het
Vps13d	A	T	4: 145,099,983	L1726Q	probably null	Het
Vwf	A	T	6: 125,603,457	Q556L	probably benign	Het
Wdr70	T	A	15: 8,035,844	M246L	probably benign	Het
Yipf3	T	C	17: 46,251,446	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,826,873	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,627,297	F125L	probably benign	Het

Other mutations in Lrig3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Lrig3	APN	10	126013148	missense	probably benign	0.00
IGL00426:Lrig3	APN	10	125972137	nonsense	probably null
IGL00969:Lrig3	APN	10	125997115	missense	probably damaging	1.00
IGL01376:Lrig3	APN	10	125994466	missense	probably benign	0.01
IGL01510:Lrig3	APN	10	126008698	missense	probably damaging	1.00
IGL01825:Lrig3	APN	10	126010017	missense	probably damaging	0.98
IGL02231:Lrig3	APN	10	125997172	missense	probably damaging	1.00
IGL02377:Lrig3	APN	10	126014874	missense	probably benign	0.00
IGL02648:Lrig3	APN	10	125966594	missense	probably benign
IGL02832:Lrig3	APN	10	126007002	missense	probably benign	0.37
IGL03266:Lrig3	APN	10	126013282	missense	probably benign	0.28
R0023:Lrig3	UTSW	10	126010219	missense	probably damaging	1.00
R0129:Lrig3	UTSW	10	126006943	missense	probably damaging	1.00
R0183:Lrig3	UTSW	10	126010192	missense	probably damaging	1.00
R0226:Lrig3	UTSW	10	125972117	splice site	probably benign
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0233:Lrig3	UTSW	10	126013526	splice site	probably null
R0336:Lrig3	UTSW	10	125966705	missense	probably benign	0.04
R0348:Lrig3	UTSW	10	126013448	nonsense	probably null
R0502:Lrig3	UTSW	10	126008736	missense	probably damaging	1.00
R0639:Lrig3	UTSW	10	126010221	missense	probably damaging	1.00
R1099:Lrig3	UTSW	10	126007014	splice site	probably null
R1220:Lrig3	UTSW	10	125997076	missense	probably damaging	1.00
R1230:Lrig3	UTSW	10	126002971	missense	probably damaging	1.00
R1451:Lrig3	UTSW	10	126010057	missense	possibly damaging	0.92
R1523:Lrig3	UTSW	10	126008698	missense	probably damaging	1.00
R1545:Lrig3	UTSW	10	126008547	missense	possibly damaging	0.80
R1661:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1665:Lrig3	UTSW	10	125997701	missense	probably benign	0.12
R1673:Lrig3	UTSW	10	126010167	missense	probably damaging	1.00
R1778:Lrig3	UTSW	10	126010075	missense	probably damaging	1.00
R1800:Lrig3	UTSW	10	125997051	splice site	probably null
R1840:Lrig3	UTSW	10	126013389	nonsense	probably null
R1882:Lrig3	UTSW	10	126009825	missense	possibly damaging	0.89
R1900:Lrig3	UTSW	10	126002393	splice site	probably benign
R2160:Lrig3	UTSW	10	125997696	missense	possibly damaging	0.95
R2200:Lrig3	UTSW	10	125996609	splice site	probably null
R2294:Lrig3	UTSW	10	125966494	nonsense	probably null
R2518:Lrig3	UTSW	10	125994441	missense	probably benign	0.07
R3037:Lrig3	UTSW	10	126010032	missense	probably damaging	1.00
R3236:Lrig3	UTSW	10	125997187	missense	probably damaging	1.00
R4073:Lrig3	UTSW	10	126013408	missense	probably benign
R4074:Lrig3	UTSW	10	126013408	missense	probably benign
R4075:Lrig3	UTSW	10	126013408	missense	probably benign
R4077:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4079:Lrig3	UTSW	10	126009787	missense	probably damaging	1.00
R4405:Lrig3	UTSW	10	126011008	missense	probably benign	0.00
R4425:Lrig3	UTSW	10	126013404	missense	probably benign	0.00
R4505:Lrig3	UTSW	10	126013347	missense	probably benign	0.00
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4860:Lrig3	UTSW	10	126011052	missense	probably benign	0.36
R4903:Lrig3	UTSW	10	125996613	critical splice acceptor site	probably null
R5201:Lrig3	UTSW	10	126013151	missense	possibly damaging	0.48
R5307:Lrig3	UTSW	10	126006690	missense	probably damaging	1.00
R5402:Lrig3	UTSW	10	126008740	missense	probably damaging	1.00
R5557:Lrig3	UTSW	10	125972134	missense	probably damaging	1.00
R5792:Lrig3	UTSW	10	126009919	missense	probably damaging	1.00
R5903:Lrig3	UTSW	10	126008478	missense	probably damaging	1.00
R6280:Lrig3	UTSW	10	126010979	missense	probably benign	0.18
R6484:Lrig3	UTSW	10	125996609	splice site	probably null
R6985:Lrig3	UTSW	10	126014869	missense	possibly damaging	0.64
R7089:Lrig3	UTSW	10	125997124	missense	probably damaging	1.00
R7177:Lrig3	UTSW	10	126006843	missense	probably benign	0.02
R7347:Lrig3	UTSW	10	126009966	missense	probably damaging	1.00
R9093:Lrig3	UTSW	10	126010081	missense	possibly damaging	0.51
R9188:Lrig3	UTSW	10	126003066	missense	possibly damaging	0.80
R9295:Lrig3	UTSW	10	126014853	missense	probably benign	0.00
R9378:Lrig3	UTSW	10	125997084	missense	probably damaging	0.98
R9526:Lrig3	UTSW	10	126014867	missense	probably benign
R9567:Lrig3	UTSW	10	126010095	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAACATCACACGTTCGGTTTCCTG -3'
(R):5'- TGTATGACATTTCCAGAAGCGGCAC -3'

Sequencing Primer
(F):5'- GGTTTGATTTACGTTTAGAAATCTGC -3'
(R):5'- CTGTAAAACTTTAACAAGCGGC -3'

Posted On

2014-03-14