Incidental Mutation 'R1398:Lrig3'
ID160246
Institutional Source Beutler Lab
Gene Symbol Lrig3
Ensembl Gene ENSMUSG00000020105
Gene Nameleucine-rich repeats and immunoglobulin-like domains 3
Synonyms9030421L11Rik, 9430095K15Rik, 9130004I02Rik
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location125966168-126015359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 126003088 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 488 (P488L)
Ref Sequence ENSEMBL: ENSMUSP00000074360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074807]
PDB Structure
Crystal structure of an Immunoglobulin I-set domain of Lrig3 protein (Lrig3) from MUS MUSCULUS at 1.70 A resolution [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000074807
AA Change: P488L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000074360
Gene: ENSMUSG00000020105
AA Change: P488L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LRRNT 46 78 6.74e-2 SMART
LRR 72 96 4.45e1 SMART
LRR 97 120 1.06e1 SMART
LRR 144 166 1.14e0 SMART
LRR 168 189 1.62e2 SMART
LRR 190 214 1.09e1 SMART
LRR 215 237 1.71e1 SMART
LRR 238 261 2.29e0 SMART
LRR 262 285 3.07e-1 SMART
LRR 286 309 2.49e-1 SMART
LRR 310 333 1.29e1 SMART
LRR 334 357 6.22e0 SMART
LRR 358 384 6.05e0 SMART
LRR_TYP 385 408 1.56e-2 SMART
LRR_TYP 409 432 1.79e-2 SMART
LRRCT 444 494 2.35e-7 SMART
IGc2 511 588 1.65e-4 SMART
IGc2 615 683 1.33e-8 SMART
IGc2 709 774 2.78e-11 SMART
transmembrane domain 805 827 N/A INTRINSIC
low complexity region 1069 1081 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220332
Meta Mutation Damage Score 0.2670 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele or severely hypomorphic gene trap allele exhibit fusion of the lateral semicircular canal and circling behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Lrig3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Lrig3 APN 10 126013148 missense probably benign 0.00
IGL00426:Lrig3 APN 10 125972137 nonsense probably null
IGL00969:Lrig3 APN 10 125997115 missense probably damaging 1.00
IGL01376:Lrig3 APN 10 125994466 missense probably benign 0.01
IGL01510:Lrig3 APN 10 126008698 missense probably damaging 1.00
IGL01825:Lrig3 APN 10 126010017 missense probably damaging 0.98
IGL02231:Lrig3 APN 10 125997172 missense probably damaging 1.00
IGL02377:Lrig3 APN 10 126014874 missense probably benign 0.00
IGL02648:Lrig3 APN 10 125966594 missense probably benign
IGL02832:Lrig3 APN 10 126007002 missense probably benign 0.37
IGL03266:Lrig3 APN 10 126013282 missense probably benign 0.28
R0023:Lrig3 UTSW 10 126010219 missense probably damaging 1.00
R0129:Lrig3 UTSW 10 126006943 missense probably damaging 1.00
R0183:Lrig3 UTSW 10 126010192 missense probably damaging 1.00
R0226:Lrig3 UTSW 10 125972117 splice site probably benign
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0233:Lrig3 UTSW 10 126013526 splice site probably null
R0336:Lrig3 UTSW 10 125966705 missense probably benign 0.04
R0348:Lrig3 UTSW 10 126013448 nonsense probably null
R0502:Lrig3 UTSW 10 126008736 missense probably damaging 1.00
R0639:Lrig3 UTSW 10 126010221 missense probably damaging 1.00
R1099:Lrig3 UTSW 10 126007014 splice site probably null
R1220:Lrig3 UTSW 10 125997076 missense probably damaging 1.00
R1230:Lrig3 UTSW 10 126002971 missense probably damaging 1.00
R1451:Lrig3 UTSW 10 126010057 missense possibly damaging 0.92
R1523:Lrig3 UTSW 10 126008698 missense probably damaging 1.00
R1545:Lrig3 UTSW 10 126008547 missense possibly damaging 0.80
R1661:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1665:Lrig3 UTSW 10 125997701 missense probably benign 0.12
R1673:Lrig3 UTSW 10 126010167 missense probably damaging 1.00
R1778:Lrig3 UTSW 10 126010075 missense probably damaging 1.00
R1800:Lrig3 UTSW 10 125997051 splice site probably null
R1840:Lrig3 UTSW 10 126013389 nonsense probably null
R1882:Lrig3 UTSW 10 126009825 missense possibly damaging 0.89
R1900:Lrig3 UTSW 10 126002393 splice site probably benign
R2160:Lrig3 UTSW 10 125997696 missense possibly damaging 0.95
R2200:Lrig3 UTSW 10 125996609 splice site probably null
R2294:Lrig3 UTSW 10 125966494 nonsense probably null
R2518:Lrig3 UTSW 10 125994441 missense probably benign 0.07
R3037:Lrig3 UTSW 10 126010032 missense probably damaging 1.00
R3236:Lrig3 UTSW 10 125997187 missense probably damaging 1.00
R4073:Lrig3 UTSW 10 126013408 missense probably benign
R4074:Lrig3 UTSW 10 126013408 missense probably benign
R4075:Lrig3 UTSW 10 126013408 missense probably benign
R4077:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4079:Lrig3 UTSW 10 126009787 missense probably damaging 1.00
R4405:Lrig3 UTSW 10 126011008 missense probably benign 0.00
R4425:Lrig3 UTSW 10 126013404 missense probably benign 0.00
R4505:Lrig3 UTSW 10 126013347 missense probably benign 0.00
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4860:Lrig3 UTSW 10 126011052 missense probably benign 0.36
R4903:Lrig3 UTSW 10 125996613 critical splice acceptor site probably null
R5201:Lrig3 UTSW 10 126013151 missense possibly damaging 0.48
R5307:Lrig3 UTSW 10 126006690 missense probably damaging 1.00
R5402:Lrig3 UTSW 10 126008740 missense probably damaging 1.00
R5557:Lrig3 UTSW 10 125972134 missense probably damaging 1.00
R5792:Lrig3 UTSW 10 126009919 missense probably damaging 1.00
R5903:Lrig3 UTSW 10 126008478 missense probably damaging 1.00
R6280:Lrig3 UTSW 10 126010979 missense probably benign 0.18
R6484:Lrig3 UTSW 10 125996609 splice site probably null
R6985:Lrig3 UTSW 10 126014869 missense possibly damaging 0.64
R7089:Lrig3 UTSW 10 125997124 missense probably damaging 1.00
R7177:Lrig3 UTSW 10 126006843 missense probably benign 0.02
R7347:Lrig3 UTSW 10 126009966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACATCACACGTTCGGTTTCCTG -3'
(R):5'- TGTATGACATTTCCAGAAGCGGCAC -3'

Sequencing Primer
(F):5'- GGTTTGATTTACGTTTAGAAATCTGC -3'
(R):5'- CTGTAAAACTTTAACAAGCGGC -3'
Posted On2014-03-14