Incidental Mutation 'R1398:Myh2'
ID 160248
Institutional Source Beutler Lab
Gene Symbol Myh2
Ensembl Gene ENSMUSG00000033196
Gene Name myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms Myhs-f, Myhsf1, MHC2A, Myhs-f1, MyHC-IIa
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R1398 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 67061853-67088343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 67076113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 767 (H767Y)
Ref Sequence ENSEMBL: ENSMUSP00000129544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018641] [ENSMUST00000170159]
AlphaFold G3UW82
Predicted Effect probably benign
Transcript: ENSMUST00000018641
AA Change: H767Y

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000018641
Gene: ENSMUSG00000033196
AA Change: H767Y

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 2.1e-16 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
low complexity region 850 862 N/A INTRINSIC
low complexity region 931 945 N/A INTRINSIC
Pfam:Myosin_tail_1 1075 1933 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170159
AA Change: H767Y

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129544
Gene: ENSMUSG00000033196
AA Change: H767Y

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 1.4e-14 PFAM
MYSc 80 786 N/A SMART
IQ 787 809 3.13e-3 SMART
IQ 813 835 3.14e2 SMART
Pfam:Myosin_tail_1 850 1931 4e-166 PFAM
Meta Mutation Damage Score 0.2161 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in inclusion body myopathy-3. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Yipf3 T C 17: 46,562,372 (GRCm39) F285S probably damaging Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Myh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Myh2 APN 11 67,076,059 (GRCm39) missense possibly damaging 0.88
IGL00330:Myh2 APN 11 67,084,266 (GRCm39) missense probably benign 0.06
IGL00423:Myh2 APN 11 67,088,171 (GRCm39) missense probably benign
IGL00429:Myh2 APN 11 67,071,616 (GRCm39) nonsense probably null
IGL00465:Myh2 APN 11 67,069,659 (GRCm39) splice site probably benign
IGL00671:Myh2 APN 11 67,084,183 (GRCm39) missense probably damaging 0.97
IGL00773:Myh2 APN 11 67,085,247 (GRCm39) missense probably benign
IGL00821:Myh2 APN 11 67,088,223 (GRCm39) utr 3 prime probably benign
IGL00900:Myh2 APN 11 67,070,210 (GRCm39) missense probably damaging 1.00
IGL01374:Myh2 APN 11 67,068,250 (GRCm39) missense probably benign 0.05
IGL01613:Myh2 APN 11 67,088,170 (GRCm39) missense probably benign 0.01
IGL01845:Myh2 APN 11 67,083,860 (GRCm39) missense probably benign 0.02
IGL01900:Myh2 APN 11 67,074,609 (GRCm39) missense probably benign 0.01
IGL01936:Myh2 APN 11 67,082,599 (GRCm39) missense possibly damaging 0.94
IGL02129:Myh2 APN 11 67,076,084 (GRCm39) missense probably benign 0.05
IGL02172:Myh2 APN 11 67,079,878 (GRCm39) missense possibly damaging 0.78
IGL02554:Myh2 APN 11 67,079,991 (GRCm39) missense probably benign 0.00
IGL02578:Myh2 APN 11 67,077,517 (GRCm39) missense probably benign 0.33
IGL03075:Myh2 APN 11 67,071,662 (GRCm39) missense probably benign 0.39
IGL03078:Myh2 APN 11 67,081,256 (GRCm39) missense probably benign
IGL03117:Myh2 APN 11 67,071,710 (GRCm39) missense possibly damaging 0.91
IGL03255:Myh2 APN 11 67,084,051 (GRCm39) missense probably damaging 1.00
IGL03266:Myh2 APN 11 67,067,150 (GRCm39) missense probably benign
IGL03366:Myh2 APN 11 67,074,349 (GRCm39) missense probably damaging 1.00
IGL03412:Myh2 APN 11 67,080,395 (GRCm39) missense probably benign 0.04
limp UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
noodle UTSW 11 67,077,438 (GRCm39) missense probably benign
PIT4403001:Myh2 UTSW 11 67,077,533 (GRCm39) missense probably benign 0.22
PIT4508001:Myh2 UTSW 11 67,076,331 (GRCm39) missense probably benign 0.00
PIT4677001:Myh2 UTSW 11 67,072,818 (GRCm39) missense probably benign
R0039:Myh2 UTSW 11 67,069,103 (GRCm39) missense probably damaging 1.00
R0347:Myh2 UTSW 11 67,076,130 (GRCm39) splice site probably benign
R0389:Myh2 UTSW 11 67,071,647 (GRCm39) missense probably damaging 1.00
R0400:Myh2 UTSW 11 67,083,424 (GRCm39) splice site probably benign
R0512:Myh2 UTSW 11 67,079,504 (GRCm39) missense probably damaging 1.00
R0555:Myh2 UTSW 11 67,069,793 (GRCm39) missense probably damaging 1.00
R0746:Myh2 UTSW 11 67,064,257 (GRCm39) missense probably benign 0.00
R0842:Myh2 UTSW 11 67,070,350 (GRCm39) missense possibly damaging 0.83
R0893:Myh2 UTSW 11 67,077,334 (GRCm39) missense possibly damaging 0.82
R1218:Myh2 UTSW 11 67,083,351 (GRCm39) missense probably damaging 0.99
R1264:Myh2 UTSW 11 67,071,604 (GRCm39) missense probably damaging 0.96
R1774:Myh2 UTSW 11 67,064,300 (GRCm39) missense possibly damaging 0.96
R1800:Myh2 UTSW 11 67,079,764 (GRCm39) missense probably damaging 0.99
R1829:Myh2 UTSW 11 67,067,385 (GRCm39) missense probably damaging 0.98
R1840:Myh2 UTSW 11 67,077,313 (GRCm39) missense probably benign 0.16
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1888:Myh2 UTSW 11 67,071,676 (GRCm39) missense probably damaging 0.99
R1969:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1971:Myh2 UTSW 11 67,080,004 (GRCm39) missense possibly damaging 0.67
R1985:Myh2 UTSW 11 67,071,740 (GRCm39) missense possibly damaging 0.65
R2021:Myh2 UTSW 11 67,082,545 (GRCm39) missense probably damaging 1.00
R2029:Myh2 UTSW 11 67,085,451 (GRCm39) missense possibly damaging 0.85
R2057:Myh2 UTSW 11 67,079,665 (GRCm39) critical splice donor site probably null
R2080:Myh2 UTSW 11 67,065,767 (GRCm39) critical splice acceptor site probably null
R2142:Myh2 UTSW 11 67,080,158 (GRCm39) missense probably damaging 1.00
R2215:Myh2 UTSW 11 67,082,563 (GRCm39) missense probably benign 0.35
R2225:Myh2 UTSW 11 67,084,555 (GRCm39) missense probably benign
R2274:Myh2 UTSW 11 67,081,184 (GRCm39) missense possibly damaging 0.84
R3018:Myh2 UTSW 11 67,070,410 (GRCm39) missense possibly damaging 0.67
R3113:Myh2 UTSW 11 67,076,012 (GRCm39) missense probably damaging 1.00
R3703:Myh2 UTSW 11 67,080,427 (GRCm39) missense probably benign 0.01
R4022:Myh2 UTSW 11 67,070,230 (GRCm39) nonsense probably null
R4081:Myh2 UTSW 11 67,081,256 (GRCm39) missense probably benign 0.11
R4191:Myh2 UTSW 11 67,068,226 (GRCm39) missense possibly damaging 0.81
R4291:Myh2 UTSW 11 67,071,985 (GRCm39) missense probably benign 0.01
R4292:Myh2 UTSW 11 67,085,723 (GRCm39) missense possibly damaging 0.46
R4424:Myh2 UTSW 11 67,083,551 (GRCm39) missense probably benign 0.01
R4524:Myh2 UTSW 11 67,067,096 (GRCm39) missense probably damaging 1.00
R4578:Myh2 UTSW 11 67,064,084 (GRCm39) missense possibly damaging 0.85
R4597:Myh2 UTSW 11 67,080,244 (GRCm39) missense probably benign 0.01
R4641:Myh2 UTSW 11 67,085,520 (GRCm39) missense probably damaging 1.00
R4672:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4673:Myh2 UTSW 11 67,079,303 (GRCm39) missense probably damaging 1.00
R4804:Myh2 UTSW 11 67,077,328 (GRCm39) missense possibly damaging 0.78
R4818:Myh2 UTSW 11 67,067,081 (GRCm39) missense probably damaging 1.00
R4943:Myh2 UTSW 11 67,088,143 (GRCm39) missense probably damaging 1.00
R4958:Myh2 UTSW 11 67,083,785 (GRCm39) missense possibly damaging 0.83
R5139:Myh2 UTSW 11 67,070,174 (GRCm39) missense probably damaging 1.00
R5239:Myh2 UTSW 11 67,083,269 (GRCm39) missense probably benign 0.00
R5306:Myh2 UTSW 11 67,077,382 (GRCm39) missense probably damaging 1.00
R5492:Myh2 UTSW 11 67,071,701 (GRCm39) missense probably benign 0.20
R5503:Myh2 UTSW 11 67,064,275 (GRCm39) missense probably benign
R5646:Myh2 UTSW 11 67,079,638 (GRCm39) missense probably benign 0.07
R5750:Myh2 UTSW 11 67,082,254 (GRCm39) missense probably benign
R5806:Myh2 UTSW 11 67,072,141 (GRCm39) missense probably damaging 0.98
R5878:Myh2 UTSW 11 67,083,330 (GRCm39) missense probably damaging 1.00
R5892:Myh2 UTSW 11 67,076,002 (GRCm39) nonsense probably null
R5898:Myh2 UTSW 11 67,083,545 (GRCm39) missense possibly damaging 0.51
R6154:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6156:Myh2 UTSW 11 67,071,879 (GRCm39) missense probably damaging 0.98
R6236:Myh2 UTSW 11 67,081,157 (GRCm39) missense probably benign 0.00
R6349:Myh2 UTSW 11 67,083,829 (GRCm39) missense probably benign 0.04
R6441:Myh2 UTSW 11 67,085,437 (GRCm39) missense probably benign 0.00
R6548:Myh2 UTSW 11 67,077,438 (GRCm39) missense probably benign
R6681:Myh2 UTSW 11 67,069,174 (GRCm39) missense probably damaging 1.00
R6907:Myh2 UTSW 11 67,084,567 (GRCm39) missense probably damaging 1.00
R6925:Myh2 UTSW 11 67,084,044 (GRCm39) missense probably benign 0.00
R6969:Myh2 UTSW 11 67,088,092 (GRCm39) missense probably benign
R7172:Myh2 UTSW 11 67,079,527 (GRCm39) missense probably benign 0.00
R7257:Myh2 UTSW 11 67,071,976 (GRCm39) missense possibly damaging 0.70
R7286:Myh2 UTSW 11 67,079,195 (GRCm39) missense probably benign 0.23
R7323:Myh2 UTSW 11 67,088,191 (GRCm39) missense probably benign
R7396:Myh2 UTSW 11 67,085,554 (GRCm39) critical splice donor site probably null
R7468:Myh2 UTSW 11 67,083,368 (GRCm39) missense probably benign 0.01
R7585:Myh2 UTSW 11 67,070,237 (GRCm39) critical splice donor site probably null
R7709:Myh2 UTSW 11 67,085,690 (GRCm39) missense probably benign 0.00
R7859:Myh2 UTSW 11 67,077,526 (GRCm39) missense probably damaging 0.96
R7908:Myh2 UTSW 11 67,088,197 (GRCm39) missense probably benign
R8062:Myh2 UTSW 11 67,084,209 (GRCm39) nonsense probably null
R8065:Myh2 UTSW 11 67,072,170 (GRCm39) missense probably null 0.01
R8093:Myh2 UTSW 11 67,079,536 (GRCm39) missense probably damaging 1.00
R8123:Myh2 UTSW 11 67,064,135 (GRCm39) missense probably benign
R8235:Myh2 UTSW 11 67,083,824 (GRCm39) missense probably damaging 1.00
R8512:Myh2 UTSW 11 67,081,187 (GRCm39) missense probably benign 0.11
R8762:Myh2 UTSW 11 67,084,578 (GRCm39) missense probably damaging 1.00
R8777:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8777-TAIL:Myh2 UTSW 11 67,083,398 (GRCm39) missense possibly damaging 0.67
R8823:Myh2 UTSW 11 67,076,300 (GRCm39) missense probably damaging 1.00
R8927:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8928:Myh2 UTSW 11 67,079,509 (GRCm39) missense probably benign 0.00
R8978:Myh2 UTSW 11 67,080,323 (GRCm39) missense probably damaging 0.98
R8978:Myh2 UTSW 11 67,068,188 (GRCm39) missense probably damaging 0.96
R9228:Myh2 UTSW 11 67,077,522 (GRCm39) missense probably benign 0.11
R9332:Myh2 UTSW 11 67,070,209 (GRCm39) missense probably damaging 1.00
R9404:Myh2 UTSW 11 67,070,454 (GRCm39) missense probably damaging 1.00
R9430:Myh2 UTSW 11 67,070,359 (GRCm39) missense probably benign 0.01
R9445:Myh2 UTSW 11 67,069,754 (GRCm39) missense probably damaging 0.98
R9542:Myh2 UTSW 11 67,072,002 (GRCm39) missense possibly damaging 0.73
R9597:Myh2 UTSW 11 67,064,302 (GRCm39) missense possibly damaging 0.75
R9654:Myh2 UTSW 11 67,088,171 (GRCm39) missense probably benign
R9704:Myh2 UTSW 11 67,071,617 (GRCm39) missense possibly damaging 0.51
R9736:Myh2 UTSW 11 67,063,999 (GRCm39) missense probably benign 0.00
R9740:Myh2 UTSW 11 67,080,052 (GRCm39) missense probably damaging 0.99
X0026:Myh2 UTSW 11 67,065,848 (GRCm39) missense probably benign 0.10
X0065:Myh2 UTSW 11 67,067,085 (GRCm39) missense probably damaging 0.99
Z1088:Myh2 UTSW 11 67,071,589 (GRCm39) critical splice acceptor site probably benign
Z1088:Myh2 UTSW 11 67,082,275 (GRCm39) missense probably damaging 0.98
Z1177:Myh2 UTSW 11 67,084,084 (GRCm39) missense probably damaging 0.99
Z1177:Myh2 UTSW 11 67,066,997 (GRCm39) missense possibly damaging 0.86
Z1188:Myh2 UTSW 11 67,079,639 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCATTAGGATAACTCCCCACATT -3'
(R):5'- GCTGGGCCAACTTGTCATCTCTCAT -3'

Sequencing Primer
(F):5'- cagaggcagaagtggtgg -3'
(R):5'- ATCTCCTCTAGGAGCCCCAG -3'
Posted On 2014-03-14