Incidental Mutation 'R1398:Cadps'
ID160257
Institutional Source Beutler Lab
Gene Symbol Cadps
Ensembl Gene ENSMUSG00000054423
Gene NameCa2+-dependent secretion activator
SynonymsCAPS1
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location12372563-12823079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 12449822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1129 (T1129K)
Ref Sequence ENSEMBL: ENSMUSP00000136076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]
Predicted Effect probably damaging
Transcript: ENSMUST00000067491
AA Change: T1134K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: T1134K

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 772 783 N/A INTRINSIC
DUF1041 833 948 6.21e-54 SMART
low complexity region 1022 1045 N/A INTRINSIC
low complexity region 1354 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112657
AA Change: T1127K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: T1127K

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 775 786 N/A INTRINSIC
DUF1041 836 941 3.88e-55 SMART
low complexity region 1015 1038 N/A INTRINSIC
low complexity region 1347 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112658
AA Change: T1128K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: T1128K

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 776 787 N/A INTRINSIC
DUF1041 837 942 3.88e-55 SMART
low complexity region 1016 1039 N/A INTRINSIC
low complexity region 1348 1355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177814
AA Change: T1129K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: T1129K

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 41 75 N/A INTRINSIC
coiled coil region 93 121 N/A INTRINSIC
C2 397 492 1.08e-2 SMART
PH 520 624 1.78e-10 SMART
low complexity region 777 788 N/A INTRINSIC
DUF1041 838 943 2.75e-55 SMART
low complexity region 1017 1040 N/A INTRINSIC
low complexity region 1349 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224106
Predicted Effect unknown
Transcript: ENSMUST00000224581
AA Change: T258K
Predicted Effect probably benign
Transcript: ENSMUST00000224882
Meta Mutation Damage Score 0.3794 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Eme2 G A 17: 24,892,918 S263F probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Cadps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Cadps APN 14 12491795 missense probably damaging 1.00
IGL00990:Cadps APN 14 12715374 missense possibly damaging 0.56
IGL01071:Cadps APN 14 12509091 splice site probably null
IGL01339:Cadps APN 14 12486543 missense possibly damaging 0.58
IGL01518:Cadps APN 14 12522352 missense probably damaging 1.00
IGL01560:Cadps APN 14 12491792 missense probably damaging 1.00
IGL01598:Cadps APN 14 12522202 critical splice donor site probably null
IGL01603:Cadps APN 14 12454154 splice site probably benign
IGL01836:Cadps APN 14 12522311 missense probably damaging 1.00
IGL01839:Cadps APN 14 12467184 splice site probably benign
IGL01932:Cadps APN 14 12373609 utr 3 prime probably benign
IGL02172:Cadps APN 14 12705681 missense probably damaging 1.00
IGL02175:Cadps APN 14 12467092 missense probably damaging 0.96
IGL02212:Cadps APN 14 12522345 missense possibly damaging 0.94
IGL02351:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02358:Cadps APN 14 12597380 missense probably damaging 0.99
IGL02499:Cadps APN 14 12822725 nonsense probably null
IGL02505:Cadps APN 14 12449759 missense probably damaging 1.00
IGL02591:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02592:Cadps APN 14 12473465 missense probably damaging 1.00
IGL02671:Cadps APN 14 12491824 missense probably damaging 1.00
IGL02956:Cadps APN 14 12418047 splice site probably benign
IGL03029:Cadps APN 14 12376675 missense probably damaging 1.00
IGL03216:Cadps APN 14 12439944 missense probably damaging 1.00
IGL03282:Cadps APN 14 12465856 splice site probably benign
turbo UTSW 14 12491800 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0241:Cadps UTSW 14 12376675 missense probably damaging 1.00
R0420:Cadps UTSW 14 12491800 missense probably damaging 1.00
R1180:Cadps UTSW 14 12457836 splice site probably benign
R1678:Cadps UTSW 14 12517802 critical splice donor site probably null
R1792:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12449802 missense possibly damaging 0.93
R1863:Cadps UTSW 14 12505796 missense probably benign 0.09
R1918:Cadps UTSW 14 12546372 missense probably damaging 0.99
R1920:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1921:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1922:Cadps UTSW 14 12465859 missense possibly damaging 0.64
R1925:Cadps UTSW 14 12705726 missense probably damaging 1.00
R1966:Cadps UTSW 14 12822450 nonsense probably null
R2013:Cadps UTSW 14 12522337 missense probably damaging 1.00
R2228:Cadps UTSW 14 12465935 missense probably benign 0.05
R2331:Cadps UTSW 14 12603692 missense probably damaging 1.00
R3436:Cadps UTSW 14 12616158 splice site probably null
R3853:Cadps UTSW 14 12509090 splice site probably benign
R3893:Cadps UTSW 14 12488883 utr 3 prime probably benign
R3916:Cadps UTSW 14 12457702 missense probably benign 0.00
R3917:Cadps UTSW 14 12457702 missense probably benign 0.00
R3953:Cadps UTSW 14 12505937 missense probably damaging 1.00
R3966:Cadps UTSW 14 12522161 splice site probably null
R4024:Cadps UTSW 14 12705539 missense probably damaging 1.00
R4079:Cadps UTSW 14 12457702 missense probably benign 0.00
R4230:Cadps UTSW 14 12488987 missense probably damaging 0.98
R4333:Cadps UTSW 14 12467031 missense probably damaging 1.00
R4410:Cadps UTSW 14 12822323 missense probably damaging 0.98
R4586:Cadps UTSW 14 12505808 missense probably damaging 1.00
R4685:Cadps UTSW 14 12467139 missense possibly damaging 0.77
R4698:Cadps UTSW 14 12705654 missense possibly damaging 0.90
R4855:Cadps UTSW 14 12822449 missense unknown
R4898:Cadps UTSW 14 12411588 missense possibly damaging 0.86
R4908:Cadps UTSW 14 12536386 missense probably damaging 1.00
R5208:Cadps UTSW 14 12457711 missense possibly damaging 0.68
R5297:Cadps UTSW 14 12822345 missense probably damaging 1.00
R5328:Cadps UTSW 14 12457790 missense probably benign 0.31
R5408:Cadps UTSW 14 12705759 missense possibly damaging 0.87
R5529:Cadps UTSW 14 12454285 missense probably damaging 1.00
R5567:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5570:Cadps UTSW 14 12473497 missense possibly damaging 0.49
R5727:Cadps UTSW 14 12486525 nonsense probably null
R5812:Cadps UTSW 14 12376685 missense probably benign
R6361:Cadps UTSW 14 12491778 nonsense probably null
R6767:Cadps UTSW 14 12550888 missense probably damaging 1.00
R6805:Cadps UTSW 14 12467103 missense probably damaging 0.99
R6861:Cadps UTSW 14 12522401 nonsense probably null
R6883:Cadps UTSW 14 12465883 missense probably damaging 0.96
R6887:Cadps UTSW 14 12505811 missense probably damaging 1.00
R6997:Cadps UTSW 14 12505793 missense possibly damaging 0.88
R7102:Cadps UTSW 14 12603738 missense probably damaging 1.00
R7120:Cadps UTSW 14 12439919 missense probably damaging 0.98
R7143:Cadps UTSW 14 12491838 missense probably benign 0.02
R7290:Cadps UTSW 14 12616099 missense probably damaging 1.00
R7614:Cadps UTSW 14 12454260 missense probably damaging 1.00
X0018:Cadps UTSW 14 12373690 missense probably damaging 1.00
X0028:Cadps UTSW 14 12467118 missense possibly damaging 0.93
Z1088:Cadps UTSW 14 12467113 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACTTCCAAGTGACTGGCACGCTC -3'
(R):5'- TGCACAGAGATCTGTCCACACAAAG -3'

Sequencing Primer
(F):5'- CGTGCCTCAGAAATTGACTTGAC -3'
(R):5'- CCTTCTAAGAAAGGGAAAGTCACTTG -3'
Posted On2014-03-14