Mutagenetix > Incidental Mutation

Incidental Mutation 'R1398:Kalrn'

160262

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

E530005C20Rik, LOC224126, Hapip, 2210407G14Rik

MMRRC Submission

039460-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.918) question?

Stock #

R1398 (G1)

Quality Score

218

Status

Validated

Chromosome

Chromosomal Location

33789443-34393647 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34033190 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 879 (Y879H)

Ref Sequence

ENSEMBL: ENSMUSP00000123416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000151491] [ENSMUST00000114961]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076810
AA Change: Y1105H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: Y1105H

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000089655
AA Change: Y1132H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: Y1132H

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114947
AA Change: Y478H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: Y478H

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114949
AA Change: Y482H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: Y482H

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114953
AA Change: Y491H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: Y491H

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114954
AA Change: Y491H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: Y491H

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114960
AA Change: Y1123H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: Y1123H

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000151491
AA Change: Y879H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: Y879H

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: Y1100H

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: Y1100H

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Meta Mutation Damage Score

0.2463

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,547,511 (GRCm39)	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,147,562 (GRCm39)		probably null	Het
Anks1b	A	G	10: 89,885,891 (GRCm39)	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926 (GRCm39)	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,001,057 (GRCm39)		probably benign	Het
C4b	T	A	17: 34,949,693 (GRCm39)		probably benign	Het
Cacna2d1	G	A	5: 16,562,764 (GRCm39)	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822 (GRCm38)	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,600,721 (GRCm39)		probably benign	Het
Cep63	A	T	9: 102,480,285 (GRCm39)		probably benign	Het
Chil4	T	A	3: 106,126,825 (GRCm39)		probably null	Het
Cnot11	A	G	1: 39,584,261 (GRCm39)	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,627,069 (GRCm39)	S254P	probably damaging	Het
Dnah11	T	A	12: 118,020,841 (GRCm39)	K87*	probably null	Het
Dpy19l2	T	A	9: 24,492,559 (GRCm39)		probably benign	Het
Dsc1	A	T	18: 20,221,393 (GRCm39)	I694N	probably damaging	Het
Ehd4	A	T	2: 119,958,081 (GRCm39)	I168K	probably benign	Het
Eif4e	A	T	3: 138,252,136 (GRCm39)	N25Y	probably damaging	Het
Elapor2	A	G	5: 9,430,297 (GRCm39)	Y69C	probably damaging	Het
Eme2	G	A	17: 25,111,892 (GRCm39)	S263F	probably damaging	Het
Fgfrl1	T	A	5: 108,854,147 (GRCm39)		probably benign	Het
Fhip2a	T	A	19: 57,361,358 (GRCm39)		probably benign	Het
Gm3159	T	A	14: 4,398,586 (GRCm38)	Y92*	probably null	Het
Gm4922	T	A	10: 18,659,496 (GRCm39)	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,691,244 (GRCm39)		probably benign	Het
Grsf1	A	G	5: 88,813,706 (GRCm39)	Y231H	probably benign	Het
Heatr4	T	A	12: 84,014,395 (GRCm39)	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647 (GRCm38)		probably benign	Het
Hoxa13	G	C	6: 52,260,648 (GRCm38)		probably benign	Het
Isg20l2	C	A	3: 87,846,061 (GRCm39)	L325I	probably benign	Het
Kcnk10	C	A	12: 98,402,485 (GRCm39)	W318L	probably damaging	Het
Kctd1	T	C	18: 15,195,654 (GRCm39)	E323G	possibly damaging	Het
Kif4	G	T	X: 99,732,703 (GRCm39)	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,518,558 (GRCm39)	T151A	unknown	Het
Ldlr	A	T	9: 21,650,838 (GRCm39)	Q449L	probably benign	Het
Lepr	T	A	4: 101,649,216 (GRCm39)	D872E	probably damaging	Het
Lgals12	C	T	19: 7,581,322 (GRCm39)		probably benign	Het
Lrig3	C	T	10: 125,838,957 (GRCm39)	P488L	probably benign	Het
Lrrc4b	A	C	7: 44,111,876 (GRCm39)	I583L	probably benign	Het
Lyst	T	C	13: 13,915,121 (GRCm39)	S3272P	possibly damaging	Het
Marchf2	T	C	17: 33,915,096 (GRCm39)	H166R	probably damaging	Het
Mtbp	C	A	15: 55,440,933 (GRCm39)	Y373*	probably null	Het
Myh2	C	T	11: 67,076,113 (GRCm39)	H767Y	probably benign	Het
Ncam1	G	A	9: 49,428,889 (GRCm39)		probably benign	Het
Neb	T	A	2: 52,179,658 (GRCm39)	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,269,119 (GRCm39)	Y428H	possibly damaging	Het
Nrros	A	T	16: 31,961,962 (GRCm39)	I649N	probably damaging	Het
Nvl	A	T	1: 180,924,691 (GRCm39)		probably benign	Het
Or5p70	T	A	7: 107,994,708 (GRCm39)	V127E	probably damaging	Het
Pms1	A	T	1: 53,246,435 (GRCm39)	V368E	possibly damaging	Het
Polq	T	A	16: 36,882,857 (GRCm39)	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,850,307 (GRCm39)	V31A	probably damaging	Het
Rev3l	T	A	10: 39,697,579 (GRCm39)	V692E	probably benign	Het
Robo4	T	C	9: 37,319,372 (GRCm39)		probably null	Het
Rps6kc1	T	C	1: 190,532,212 (GRCm39)	I597V	probably damaging	Het
Rtel1	T	A	2: 180,977,658 (GRCm39)		probably null	Het
Scn9a	A	G	2: 66,314,930 (GRCm39)	M1587T	probably benign	Het
Sec31b	T	A	19: 44,512,104 (GRCm39)	I597F	probably benign	Het
Skint5	T	C	4: 113,636,268 (GRCm39)	N650S	unknown	Het
Slc22a28	G	T	19: 8,107,566 (GRCm39)	S167*	probably null	Het
Slfn1	T	A	11: 83,011,968 (GRCm39)	M28K	probably damaging	Het
Smc6	T	C	12: 11,321,880 (GRCm39)		probably benign	Het
Sox8	T	C	17: 25,786,857 (GRCm39)	H282R	probably benign	Het
Spata31e2	G	T	1: 26,724,422 (GRCm39)	Q253K	possibly damaging	Het
Syngr3	C	A	17: 24,905,414 (GRCm39)	V161L	probably benign	Het
Trak1	C	T	9: 121,283,425 (GRCm39)	S397F	probably damaging	Het
Uso1	C	T	5: 92,329,327 (GRCm39)	A405V	probably benign	Het
Uvrag	G	T	7: 98,715,027 (GRCm39)	Y190*	probably null	Het
Vps13d	A	T	4: 144,826,553 (GRCm39)	L1726Q	probably null	Het
Vwf	A	T	6: 125,580,420 (GRCm39)	Q556L	probably benign	Het
Wdr70	T	A	15: 8,065,325 (GRCm39)	M246L	probably benign	Het
Yipf3	T	C	17: 46,562,372 (GRCm39)	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,476,621 (GRCm39)	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,354,608 (GRCm39)	F125L	probably benign	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	33,996,092 (GRCm39)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,082,999 (GRCm39)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,055,700 (GRCm39)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,114,531 (GRCm39)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,018,882 (GRCm39)	splice site	probably null
IGL02059:Kalrn	APN	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,040,592 (GRCm39)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,130,897 (GRCm39)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,152,594 (GRCm39)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,181,216 (GRCm39)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,334,329 (GRCm39)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,040,484 (GRCm39)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,212,420 (GRCm39)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,040,500 (GRCm39)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,134,562 (GRCm39)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,205,667 (GRCm39)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,134,546 (GRCm39)	missense	probably damaging	0.99
breeze	UTSW	16	33,834,045 (GRCm39)	missense
ethereal	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
Feather	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
Hidden	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
Soulful	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,018,884 (GRCm39)	splice site	probably benign
R0043:Kalrn	UTSW	16	33,875,276 (GRCm39)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,177,541 (GRCm39)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,795,989 (GRCm39)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	33,851,960 (GRCm39)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	33,870,306 (GRCm39)	intron	probably benign
R0183:Kalrn	UTSW	16	33,991,749 (GRCm39)	splice site	probably null
R0422:Kalrn	UTSW	16	34,134,643 (GRCm39)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	33,875,261 (GRCm39)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,814,040 (GRCm39)	splice site	probably benign
R0656:Kalrn	UTSW	16	33,852,837 (GRCm39)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	33,936,778 (GRCm39)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	33,830,951 (GRCm39)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	33,855,924 (GRCm39)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	33,870,289 (GRCm39)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,205,760 (GRCm39)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	33,836,868 (GRCm39)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,795,954 (GRCm39)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,809,173 (GRCm39)	missense	probably benign	0.01
R1427:Kalrn	UTSW	16	33,796,124 (GRCm39)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	33,994,857 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,007,841 (GRCm39)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,134,648 (GRCm39)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	33,830,918 (GRCm39)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,181,320 (GRCm39)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,033,243 (GRCm39)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,114,585 (GRCm39)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,177,331 (GRCm39)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,796,293 (GRCm39)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,212,463 (GRCm39)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,797,894 (GRCm39)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,796,108 (GRCm39)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	33,848,415 (GRCm39)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,010,106 (GRCm39)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,072,680 (GRCm39)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,152,513 (GRCm39)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,152,600 (GRCm39)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,128,094 (GRCm39)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	33,829,632 (GRCm39)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	33,996,632 (GRCm39)	splice site	probably null
R2404:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,130,865 (GRCm39)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,032,642 (GRCm39)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,177,685 (GRCm39)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,212,400 (GRCm39)	splice site	probably null
R3788:Kalrn	UTSW	16	34,040,610 (GRCm39)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	33,860,259 (GRCm39)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,024,226 (GRCm39)	splice site	probably null
R3934:Kalrn	UTSW	16	34,130,901 (GRCm39)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,134,579 (GRCm39)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,055,761 (GRCm39)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,807,578 (GRCm39)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,212,412 (GRCm39)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,055,637 (GRCm39)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,334,296 (GRCm39)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	33,849,075 (GRCm39)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	33,996,761 (GRCm39)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,024,327 (GRCm39)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,018,857 (GRCm39)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,810,180 (GRCm39)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,177,339 (GRCm39)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,334,389 (GRCm39)	unclassified	probably benign
R4888:Kalrn	UTSW	16	33,991,700 (GRCm39)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,177,785 (GRCm39)	splice site	probably null
R5030:Kalrn	UTSW	16	33,796,112 (GRCm39)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,134,722 (GRCm39)	nonsense	probably null
R5117:Kalrn	UTSW	16	33,853,971 (GRCm39)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,072,711 (GRCm39)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,083,023 (GRCm39)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	33,873,992 (GRCm39)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	33,996,150 (GRCm39)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	33,860,304 (GRCm39)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	33,834,454 (GRCm39)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	33,836,949 (GRCm39)	missense	probably benign
R5716:Kalrn	UTSW	16	33,807,546 (GRCm39)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,796,190 (GRCm39)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,032,619 (GRCm39)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,807,461 (GRCm39)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,795,805 (GRCm39)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,064,203 (GRCm39)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,177,713 (GRCm39)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	33,830,950 (GRCm39)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,181,255 (GRCm39)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,805,561 (GRCm39)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,033,255 (GRCm39)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,177,481 (GRCm39)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	33,874,009 (GRCm39)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	33,875,441 (GRCm39)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,796,361 (GRCm39)	missense	probably benign
R6397:Kalrn	UTSW	16	33,813,355 (GRCm39)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,152,534 (GRCm39)	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34,025,672 (GRCm39)	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34,181,354 (GRCm39)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,003,117 (GRCm39)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,038,293 (GRCm39)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	33,848,346 (GRCm39)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,796,073 (GRCm39)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,040,506 (GRCm39)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,177,418 (GRCm39)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,038,261 (GRCm39)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,076,597 (GRCm39)	missense	unknown
R7154:Kalrn	UTSW	16	34,032,527 (GRCm39)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	33,983,447 (GRCm39)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	33,996,792 (GRCm39)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	33,996,131 (GRCm39)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,076,603 (GRCm39)	missense	unknown
R7563:Kalrn	UTSW	16	34,212,464 (GRCm39)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,134,582 (GRCm39)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	33,851,952 (GRCm39)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,007,854 (GRCm39)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,810,161 (GRCm39)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,809,217 (GRCm39)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	33,849,122 (GRCm39)	missense	probably benign
R8080:Kalrn	UTSW	16	33,796,038 (GRCm39)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	33,875,414 (GRCm39)	missense	probably benign
R8239:Kalrn	UTSW	16	33,870,153 (GRCm39)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	33,855,431 (GRCm39)	nonsense	probably null
R8294:Kalrn	UTSW	16	33,853,954 (GRCm39)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,177,470 (GRCm39)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,181,305 (GRCm39)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	33,854,884 (GRCm39)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,803,225 (GRCm39)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,025,696 (GRCm39)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,018,830 (GRCm39)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,038,305 (GRCm39)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,814,025 (GRCm39)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,047,496 (GRCm39)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	33,854,854 (GRCm39)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,181,371 (GRCm39)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	33,834,045 (GRCm39)	missense
R9424:Kalrn	UTSW	16	33,809,188 (GRCm39)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	33,916,249 (GRCm39)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,805,600 (GRCm39)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	33,854,864 (GRCm39)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	33,849,197 (GRCm39)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,032,583 (GRCm39)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	33,860,303 (GRCm39)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	33,855,876 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTCAGACCCAGTGAGTTGAGTAG -3'
(R):5'- AGGTTGTTACCAAGCATTCCCCG -3'

Sequencing Primer
(F):5'- GTCAGACCCTGTGAATACCTGTG -3'
(R):5'- CTAAAGGGAGGCTTACCAGTCC -3'

Posted On

2014-03-14