Incidental Mutation 'R1398:Eme2'
ID160267
Institutional Source Beutler Lab
Gene Symbol Eme2
Ensembl Gene ENSMUSG00000073436
Gene Nameessential meiotic structure-specific endonuclease subunit 2
Synonyms
MMRRC Submission 039460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1398 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24888486-24895087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24892918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 263 (S263F)
Ref Sequence ENSEMBL: ENSMUSP00000113936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024976] [ENSMUST00000024978] [ENSMUST00000043907] [ENSMUST00000068508] [ENSMUST00000088345] [ENSMUST00000115228] [ENSMUST00000115229] [ENSMUST00000117509] [ENSMUST00000117890] [ENSMUST00000119829] [ENSMUST00000119848] [ENSMUST00000120943] [ENSMUST00000121542] [ENSMUST00000121723] [ENSMUST00000121787] [ENSMUST00000130194] [ENSMUST00000139754] [ENSMUST00000144430] [ENSMUST00000146923] [ENSMUST00000154236] [ENSMUST00000168265] [ENSMUST00000178969]
Predicted Effect probably benign
Transcript: ENSMUST00000024976
SMART Domains Protein: ENSMUSP00000024976
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
Pfam:SPRY 181 304 5.7e-18 PFAM
SOCS_box 309 347 2.8e0 SMART
low complexity region 364 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000024978
SMART Domains Protein: ENSMUSP00000024978
Gene: ENSMUSG00000073435

DomainStartEndE-ValueType
NDK 21 158 1.06e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043907
SMART Domains Protein: ENSMUSP00000045111
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
Pfam:MRP-S34 61 187 5.3e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068508
SMART Domains Protein: ENSMUSP00000068567
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 252 1.3e-13 PFAM
low complexity region 295 308 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088345
SMART Domains Protein: ENSMUSP00000085683
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115228
SMART Domains Protein: ENSMUSP00000110883
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 411 466 7e-20 PDB
low complexity region 567 581 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
SCOP:d1flga_ 972 1152 3e-8 SMART
Blast:WD40 1060 1101 6e-18 BLAST
low complexity region 1245 1261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115229
SMART Domains Protein: ENSMUSP00000110884
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 184 2.9e-60 PFAM
low complexity region 244 257 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:JIP_LZII 423 493 3.1e-32 PFAM
coiled coil region 533 563 N/A INTRINSIC
low complexity region 590 604 N/A INTRINSIC
low complexity region 762 777 N/A INTRINSIC
low complexity region 901 909 N/A INTRINSIC
low complexity region 936 948 N/A INTRINSIC
SCOP:d1flga_ 995 1175 4e-8 SMART
Blast:WD40 1083 1124 7e-18 BLAST
low complexity region 1268 1284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117509
SMART Domains Protein: ENSMUSP00000112712
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 238 247 N/A INTRINSIC
PDB:2W83|D 394 449 7e-20 PDB
coiled coil region 502 532 N/A INTRINSIC
low complexity region 559 573 N/A INTRINSIC
low complexity region 731 746 N/A INTRINSIC
low complexity region 870 878 N/A INTRINSIC
low complexity region 905 917 N/A INTRINSIC
SCOP:d1flga_ 964 1144 3e-8 SMART
Blast:WD40 1052 1093 6e-18 BLAST
low complexity region 1237 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117890
SMART Domains Protein: ENSMUSP00000112380
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119829
SMART Domains Protein: ENSMUSP00000112589
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 294 6.9e-16 PFAM
SOCS_box 299 337 2.8e0 SMART
low complexity region 354 363 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119848
AA Change: S263F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113167
Gene: ENSMUSG00000073436
AA Change: S263F

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 8.51e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120943
SMART Domains Protein: ENSMUSP00000112492
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Pfam:SPRY 146 269 1.6e-18 PFAM
SOCS_box 274 312 2.8e0 SMART
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121542
AA Change: S263F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113936
Gene: ENSMUSG00000073436
AA Change: S263F

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
ERCC4 71 320 1.4e-23 SMART
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121723
SMART Domains Protein: ENSMUSP00000113698
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1e-72 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 386 441 7e-20 PDB
coiled coil region 494 524 N/A INTRINSIC
low complexity region 551 565 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 862 870 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
SCOP:d1flga_ 956 1136 3e-8 SMART
Blast:WD40 1044 1085 5e-18 BLAST
low complexity region 1229 1245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121787
SMART Domains Protein: ENSMUSP00000113753
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 3.8e-73 PFAM
low complexity region 230 239 N/A INTRINSIC
PDB:2W83|D 380 435 8e-20 PDB
coiled coil region 488 518 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
low complexity region 856 864 N/A INTRINSIC
low complexity region 891 903 N/A INTRINSIC
SCOP:d1flga_ 950 1130 3e-8 SMART
Blast:WD40 1038 1079 6e-18 BLAST
low complexity region 1223 1239 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128953
Predicted Effect probably benign
Transcript: ENSMUST00000130194
SMART Domains Protein: ENSMUSP00000119896
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 17 30 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138648
Predicted Effect probably benign
Transcript: ENSMUST00000139754
SMART Domains Protein: ENSMUSP00000118245
Gene: ENSMUSG00000073436

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140688
Predicted Effect probably benign
Transcript: ENSMUST00000144430
SMART Domains Protein: ENSMUSP00000117226
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145882
Predicted Effect probably benign
Transcript: ENSMUST00000146923
SMART Domains Protein: ENSMUSP00000114802
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.4e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 4e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150500
Predicted Effect probably benign
Transcript: ENSMUST00000154236
SMART Domains Protein: ENSMUSP00000120985
Gene: ENSMUSG00000038880

DomainStartEndE-ValueType
low complexity region 9 25 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
Blast:NDK 172 208 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156659
Predicted Effect probably benign
Transcript: ENSMUST00000168265
SMART Domains Protein: ENSMUSP00000126878
Gene: ENSMUSG00000024160

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
low complexity region 55 69 N/A INTRINSIC
low complexity region 145 156 N/A INTRINSIC
low complexity region 163 176 N/A INTRINSIC
low complexity region 184 195 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
Pfam:SPRY 294 416 5.8e-20 PFAM
SOCS_box 420 458 2.8e0 SMART
low complexity region 475 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178969
SMART Domains Protein: ENSMUSP00000136924
Gene: ENSMUSG00000024163

DomainStartEndE-ValueType
Pfam:Jnk-SapK_ap_N 29 186 1.1e-72 PFAM
low complexity region 236 249 N/A INTRINSIC
low complexity region 261 270 N/A INTRINSIC
PDB:2W83|D 417 472 6e-20 PDB
coiled coil region 525 555 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
low complexity region 754 769 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
SCOP:d1flga_ 987 1167 3e-8 SMART
Blast:WD40 1075 1116 6e-18 BLAST
low complexity region 1260 1276 N/A INTRINSIC
Meta Mutation Damage Score 0.3316 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EME2 forms a heterodimer with MUS81 (MIM 606591) that functions as an XPF (MIM 278760)-type flap/fork endonuclease in DNA repair (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,341 Q253K possibly damaging Het
9330182L06Rik A G 5: 9,380,297 Y69C probably damaging Het
Abca17 T C 17: 24,328,537 K288E probably damaging Het
Aldh3a2 T C 11: 61,256,736 probably null Het
Anks1b A G 10: 90,050,029 T196A probably damaging Het
Anks6 T A 4: 47,044,926 T327S possibly damaging Het
Bdh2 T C 3: 135,295,296 probably benign Het
C4b T A 17: 34,730,719 probably benign Het
Cacna2d1 G A 5: 16,357,766 V847I possibly damaging Het
Cadps G T 14: 12,449,822 T1129K probably damaging Het
Cdc45 A G 16: 18,781,971 probably benign Het
Cep63 A T 9: 102,603,086 probably benign Het
Chil4 T A 3: 106,219,509 probably null Het
Cnot11 A G 1: 39,545,180 R478G probably damaging Het
Cyp2c67 A G 19: 39,638,625 S254P probably damaging Het
Dnah11 T A 12: 118,057,106 K87* probably null Het
Dpy19l2 T A 9: 24,581,263 probably benign Het
Dsc1 A T 18: 20,088,336 I694N probably damaging Het
Ehd4 A T 2: 120,127,600 I168K probably benign Het
Eif4e A T 3: 138,546,375 N25Y probably damaging Het
Fam160b1 T A 19: 57,372,926 probably benign Het
Fgfrl1 T A 5: 108,706,281 probably benign Het
Gm3159 T A 14: 4,398,586 Y92* probably null Het
Gm4922 T A 10: 18,783,748 S409C possibly damaging Het
Gmcl1 G A 6: 86,714,262 probably benign Het
Grsf1 A G 5: 88,665,847 Y231H probably benign Het
Heatr4 T A 12: 83,967,621 H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Isg20l2 C A 3: 87,938,754 L325I probably benign Het
Kalrn A G 16: 34,212,820 Y879H probably damaging Het
Kcnk10 C A 12: 98,436,226 W318L probably damaging Het
Kctd1 T C 18: 15,062,597 E323G possibly damaging Het
Kif4 G T X: 100,689,097 A492S probably benign Het
Krtap4-1 T C 11: 99,627,732 T151A unknown Het
Ldlr A T 9: 21,739,542 Q449L probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lgals12 C T 19: 7,603,957 probably benign Het
Lrig3 C T 10: 126,003,088 P488L probably benign Het
Lrrc4b A C 7: 44,462,452 I583L probably benign Het
Lyst T C 13: 13,740,536 S3272P possibly damaging Het
March2 T C 17: 33,696,122 H166R probably damaging Het
Mtbp C A 15: 55,577,537 Y373* probably null Het
Myh2 C T 11: 67,185,287 H767Y probably benign Het
Ncam1 G A 9: 49,517,589 probably benign Het
Neb T A 2: 52,289,646 N1282Y probably damaging Het
Nectin3 A G 16: 46,448,756 Y428H possibly damaging Het
Nrros A T 16: 32,143,144 I649N probably damaging Het
Nvl A T 1: 181,097,126 probably benign Het
Olfr495 T A 7: 108,395,501 V127E probably damaging Het
Pms1 A T 1: 53,207,276 V368E possibly damaging Het
Polq T A 16: 37,062,495 S1674T possibly damaging Het
Ppp1r21 T C 17: 88,542,879 V31A probably damaging Het
Rev3l T A 10: 39,821,583 V692E probably benign Het
Robo4 T C 9: 37,408,076 probably null Het
Rps6kc1 T C 1: 190,800,015 I597V probably damaging Het
Rtel1 T A 2: 181,335,865 probably null Het
Scn9a A G 2: 66,484,586 M1587T probably benign Het
Sec31b T A 19: 44,523,665 I597F probably benign Het
Skint5 T C 4: 113,779,071 N650S unknown Het
Slc22a28 G T 19: 8,130,202 S167* probably null Het
Slfn1 T A 11: 83,121,142 M28K probably damaging Het
Smc6 T C 12: 11,271,879 probably benign Het
Sox8 T C 17: 25,567,883 H282R probably benign Het
Syngr3 C A 17: 24,686,440 V161L probably benign Het
Trak1 C T 9: 121,454,359 S397F probably damaging Het
Uso1 C T 5: 92,181,468 A405V probably benign Het
Uvrag G T 7: 99,065,820 Y190* probably null Het
Vps13d A T 4: 145,099,983 L1726Q probably null Het
Vwf A T 6: 125,603,457 Q556L probably benign Het
Wdr70 T A 15: 8,035,844 M246L probably benign Het
Yipf3 T C 17: 46,251,446 F285S probably damaging Het
Zdhhc13 G A 7: 48,826,873 G579R probably damaging Het
Zdhhc18 G C 4: 133,627,297 F125L probably benign Het
Other mutations in Eme2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Eme2 APN 17 24893346 missense possibly damaging 0.53
R0930:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1163:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1302:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1386:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1522:Eme2 UTSW 17 24892918 missense probably damaging 1.00
R1762:Eme2 UTSW 17 24893393 missense probably benign 0.00
R2327:Eme2 UTSW 17 24894183 missense probably damaging 1.00
R4410:Eme2 UTSW 17 24893624 missense probably benign 0.05
R4635:Eme2 UTSW 17 24894908 missense probably benign 0.12
R7285:Eme2 UTSW 17 24894569 critical splice donor site probably null
R7315:Eme2 UTSW 17 24894866 missense probably damaging 1.00
R7316:Eme2 UTSW 17 24894866 missense probably damaging 1.00
Z1088:Eme2 UTSW 17 24894567 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGGATTTAGGGGACTCACCTGTTG -3'
(R):5'- TCCATGCAAACCTGGATGTGCTG -3'

Sequencing Primer
(F):5'- TCACCTGTTGCAAAAGGCG -3'
(R):5'- CTTCGTGGCAGGAGCTGAG -3'
Posted On2014-03-14