Incidental Mutation 'R1398:Yipf3'
ID 160271
Institutional Source Beutler Lab
Gene Symbol Yipf3
Ensembl Gene ENSMUSG00000071074
Gene Name Yip1 domain family, member 3
Synonyms D17Wsu94e
MMRRC Submission 039460-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.578) question?
Stock # R1398 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 46559019-46563474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46562372 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 285 (F285S)
Ref Sequence ENSEMBL: ENSMUSP00000092897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000095262] [ENSMUST00000095263] [ENSMUST00000123311] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
AlphaFold Q3UDR8
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095262
SMART Domains Protein: ENSMUSP00000092896
Gene: ENSMUSG00000071073

DomainStartEndE-ValueType
LRR 27 54 2.42e1 SMART
LRR 84 111 3.47e1 SMART
LRR 112 139 1.84e0 SMART
LRR 143 171 1.66e2 SMART
LRR 172 199 5.41e0 SMART
LRR 200 227 3.54e0 SMART
LRR 229 256 5.48e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095263
AA Change: F285S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092897
Gene: ENSMUSG00000071074
AA Change: F285S

DomainStartEndE-ValueType
low complexity region 59 75 N/A INTRINSIC
transmembrane domain 146 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123311
AA Change: F190S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115951
Gene: ENSMUSG00000071074
AA Change: F190S

DomainStartEndE-ValueType
transmembrane domain 51 73 N/A INTRINSIC
transmembrane domain 88 110 N/A INTRINSIC
transmembrane domain 117 139 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 177 199 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124126
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127378
SMART Domains Protein: ENSMUSP00000114937
Gene: ENSMUSG00000071074

DomainStartEndE-ValueType
Pfam:Yip1 30 178 4.6e-13 PFAM
low complexity region 189 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151488
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Meta Mutation Damage Score 0.6447 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 96% (75/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,547,511 (GRCm39) K288E probably damaging Het
Aldh3a2 T C 11: 61,147,562 (GRCm39) probably null Het
Anks1b A G 10: 89,885,891 (GRCm39) T196A probably damaging Het
Anks6 T A 4: 47,044,926 (GRCm39) T327S possibly damaging Het
Bdh2 T C 3: 135,001,057 (GRCm39) probably benign Het
C4b T A 17: 34,949,693 (GRCm39) probably benign Het
Cacna2d1 G A 5: 16,562,764 (GRCm39) V847I possibly damaging Het
Cadps G T 14: 12,449,822 (GRCm38) T1129K probably damaging Het
Cdc45 A G 16: 18,600,721 (GRCm39) probably benign Het
Cep63 A T 9: 102,480,285 (GRCm39) probably benign Het
Chil4 T A 3: 106,126,825 (GRCm39) probably null Het
Cnot11 A G 1: 39,584,261 (GRCm39) R478G probably damaging Het
Cyp2c67 A G 19: 39,627,069 (GRCm39) S254P probably damaging Het
Dnah11 T A 12: 118,020,841 (GRCm39) K87* probably null Het
Dpy19l2 T A 9: 24,492,559 (GRCm39) probably benign Het
Dsc1 A T 18: 20,221,393 (GRCm39) I694N probably damaging Het
Ehd4 A T 2: 119,958,081 (GRCm39) I168K probably benign Het
Eif4e A T 3: 138,252,136 (GRCm39) N25Y probably damaging Het
Elapor2 A G 5: 9,430,297 (GRCm39) Y69C probably damaging Het
Eme2 G A 17: 25,111,892 (GRCm39) S263F probably damaging Het
Fgfrl1 T A 5: 108,854,147 (GRCm39) probably benign Het
Fhip2a T A 19: 57,361,358 (GRCm39) probably benign Het
Gm3159 T A 14: 4,398,586 (GRCm38) Y92* probably null Het
Gm4922 T A 10: 18,659,496 (GRCm39) S409C possibly damaging Het
Gmcl1 G A 6: 86,691,244 (GRCm39) probably benign Het
Grsf1 A G 5: 88,813,706 (GRCm39) Y231H probably benign Het
Heatr4 T A 12: 84,014,395 (GRCm39) H614L possibly damaging Het
Hoxa13 C G 6: 52,260,647 (GRCm38) probably benign Het
Hoxa13 G C 6: 52,260,648 (GRCm38) probably benign Het
Isg20l2 C A 3: 87,846,061 (GRCm39) L325I probably benign Het
Kalrn A G 16: 34,033,190 (GRCm39) Y879H probably damaging Het
Kcnk10 C A 12: 98,402,485 (GRCm39) W318L probably damaging Het
Kctd1 T C 18: 15,195,654 (GRCm39) E323G possibly damaging Het
Kif4 G T X: 99,732,703 (GRCm39) A492S probably benign Het
Krtap4-1 T C 11: 99,518,558 (GRCm39) T151A unknown Het
Ldlr A T 9: 21,650,838 (GRCm39) Q449L probably benign Het
Lepr T A 4: 101,649,216 (GRCm39) D872E probably damaging Het
Lgals12 C T 19: 7,581,322 (GRCm39) probably benign Het
Lrig3 C T 10: 125,838,957 (GRCm39) P488L probably benign Het
Lrrc4b A C 7: 44,111,876 (GRCm39) I583L probably benign Het
Lyst T C 13: 13,915,121 (GRCm39) S3272P possibly damaging Het
Marchf2 T C 17: 33,915,096 (GRCm39) H166R probably damaging Het
Mtbp C A 15: 55,440,933 (GRCm39) Y373* probably null Het
Myh2 C T 11: 67,076,113 (GRCm39) H767Y probably benign Het
Ncam1 G A 9: 49,428,889 (GRCm39) probably benign Het
Neb T A 2: 52,179,658 (GRCm39) N1282Y probably damaging Het
Nectin3 A G 16: 46,269,119 (GRCm39) Y428H possibly damaging Het
Nrros A T 16: 31,961,962 (GRCm39) I649N probably damaging Het
Nvl A T 1: 180,924,691 (GRCm39) probably benign Het
Or5p70 T A 7: 107,994,708 (GRCm39) V127E probably damaging Het
Pms1 A T 1: 53,246,435 (GRCm39) V368E possibly damaging Het
Polq T A 16: 36,882,857 (GRCm39) S1674T possibly damaging Het
Ppp1r21 T C 17: 88,850,307 (GRCm39) V31A probably damaging Het
Rev3l T A 10: 39,697,579 (GRCm39) V692E probably benign Het
Robo4 T C 9: 37,319,372 (GRCm39) probably null Het
Rps6kc1 T C 1: 190,532,212 (GRCm39) I597V probably damaging Het
Rtel1 T A 2: 180,977,658 (GRCm39) probably null Het
Scn9a A G 2: 66,314,930 (GRCm39) M1587T probably benign Het
Sec31b T A 19: 44,512,104 (GRCm39) I597F probably benign Het
Skint5 T C 4: 113,636,268 (GRCm39) N650S unknown Het
Slc22a28 G T 19: 8,107,566 (GRCm39) S167* probably null Het
Slfn1 T A 11: 83,011,968 (GRCm39) M28K probably damaging Het
Smc6 T C 12: 11,321,880 (GRCm39) probably benign Het
Sox8 T C 17: 25,786,857 (GRCm39) H282R probably benign Het
Spata31e2 G T 1: 26,724,422 (GRCm39) Q253K possibly damaging Het
Syngr3 C A 17: 24,905,414 (GRCm39) V161L probably benign Het
Trak1 C T 9: 121,283,425 (GRCm39) S397F probably damaging Het
Uso1 C T 5: 92,329,327 (GRCm39) A405V probably benign Het
Uvrag G T 7: 98,715,027 (GRCm39) Y190* probably null Het
Vps13d A T 4: 144,826,553 (GRCm39) L1726Q probably null Het
Vwf A T 6: 125,580,420 (GRCm39) Q556L probably benign Het
Wdr70 T A 15: 8,065,325 (GRCm39) M246L probably benign Het
Zdhhc13 G A 7: 48,476,621 (GRCm39) G579R probably damaging Het
Zdhhc18 G C 4: 133,354,608 (GRCm39) F125L probably benign Het
Other mutations in Yipf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Yipf3 APN 17 46,561,383 (GRCm39) critical splice donor site probably null
IGL02469:Yipf3 APN 17 46,561,384 (GRCm39) critical splice donor site probably null
IGL02836:Yipf3 APN 17 46,562,520 (GRCm39) missense possibly damaging 0.63
R0077:Yipf3 UTSW 17 46,562,503 (GRCm39) missense probably benign 0.42
R0334:Yipf3 UTSW 17 46,559,238 (GRCm39) missense possibly damaging 0.93
R0398:Yipf3 UTSW 17 46,562,411 (GRCm39) missense possibly damaging 0.86
R1163:Yipf3 UTSW 17 46,562,155 (GRCm39) critical splice donor site probably null
R1556:Yipf3 UTSW 17 46,561,793 (GRCm39) missense probably damaging 1.00
R1588:Yipf3 UTSW 17 46,561,787 (GRCm39) missense possibly damaging 0.96
R7238:Yipf3 UTSW 17 46,562,585 (GRCm39) missense probably benign
R7347:Yipf3 UTSW 17 46,561,753 (GRCm39) missense probably damaging 0.99
R7355:Yipf3 UTSW 17 46,561,566 (GRCm39) missense probably damaging 0.97
R7366:Yipf3 UTSW 17 46,559,855 (GRCm39) missense possibly damaging 0.93
R7840:Yipf3 UTSW 17 46,561,790 (GRCm39) missense probably benign 0.28
R9124:Yipf3 UTSW 17 46,559,895 (GRCm39) missense probably benign
R9223:Yipf3 UTSW 17 46,559,798 (GRCm39) missense probably damaging 1.00
RF026:Yipf3 UTSW 17 46,559,898 (GRCm39) unclassified probably benign
RF035:Yipf3 UTSW 17 46,559,898 (GRCm39) unclassified probably benign
RF039:Yipf3 UTSW 17 46,559,898 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTGTCTGCCCCACAAAGAG -3'
(R):5'- TTTCAGAGAGGGTCAATGTGACTGC -3'

Sequencing Primer
(F):5'- GCTCTAGAAGGATGCACTGAC -3'
(R):5'- GCAGAGTCACTGCTATTGCC -3'
Posted On 2014-03-14