Mutagenetix > Incidental Mutations

Incidental Mutation 'R1398:Sec31b'

160278

Institutional Source

Beutler Lab

Gene Symbol

Sec31b

Ensembl Gene

ENSMUSG00000051984

Gene Name

Sec31 homolog B (S. cerevisiae)

Synonyms

LOC240667, Sec31l2

MMRRC Submission

039460-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R1398 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44516957-44545864 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44523665 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 597 (I597F)

Ref Sequence

ENSEMBL: ENSMUSP00000107616 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063632] [ENSMUST00000111985]

Predicted Effect

probably benign
Transcript: ENSMUST00000063632
AA Change: I754F

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000064900
Gene: ENSMUSG00000051984
AA Change: I754F

Domain	Start	End	E-Value	Type
Blast:WD40	56	101	5e-18	BLAST
WD40	110	150	4.76e-6	SMART
WD40	159	197	1.53e1	SMART
WD40	200	245	1.85e0	SMART
WD40	249	289	2.15e-4	SMART
WD40	292	332	6.19e-1	SMART
low complexity region	551	561	N/A	INTRINSIC
low complexity region	822	841	N/A	INTRINSIC
low complexity region	909	929	N/A	INTRINSIC
low complexity region	1009	1018	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111985
AA Change: I597F

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000107616
Gene: ENSMUSG00000051984
AA Change: I597F

Domain	Start	End	E-Value	Type
WD40	2	40	1.53e1	SMART
WD40	43	88	1.85e0	SMART
WD40	92	132	2.15e-4	SMART
WD40	135	175	6.19e-1	SMART
Pfam:Sec16_C	394	612	1.3e-7	PFAM
low complexity region	665	684	N/A	INTRINSIC
low complexity region	752	772	N/A	INTRINSIC
low complexity region	852	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165758

SMART Domains

Protein: ENSMUSP00000130598
Gene: ENSMUSG00000051984

Domain	Start	End	E-Value	Type
low complexity region	17	36	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 90.7%

Validation Efficiency

96% (75/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	G	T	1: 26,685,341	Q253K	possibly damaging	Het
9330182L06Rik	A	G	5: 9,380,297	Y69C	probably damaging	Het
Abca17	T	C	17: 24,328,537	K288E	probably damaging	Het
Aldh3a2	T	C	11: 61,256,736		probably null	Het
Anks1b	A	G	10: 90,050,029	T196A	probably damaging	Het
Anks6	T	A	4: 47,044,926	T327S	possibly damaging	Het
Bdh2	T	C	3: 135,295,296		probably benign	Het
C4b	T	A	17: 34,730,719		probably benign	Het
Cacna2d1	G	A	5: 16,357,766	V847I	possibly damaging	Het
Cadps	G	T	14: 12,449,822	T1129K	probably damaging	Het
Cdc45	A	G	16: 18,781,971		probably benign	Het
Cep63	A	T	9: 102,603,086		probably benign	Het
Chil4	T	A	3: 106,219,509		probably null	Het
Cnot11	A	G	1: 39,545,180	R478G	probably damaging	Het
Cyp2c67	A	G	19: 39,638,625	S254P	probably damaging	Het
Dnah11	T	A	12: 118,057,106	K87*	probably null	Het
Dpy19l2	T	A	9: 24,581,263		probably benign	Het
Dsc1	A	T	18: 20,088,336	I694N	probably damaging	Het
Ehd4	A	T	2: 120,127,600	I168K	probably benign	Het
Eif4e	A	T	3: 138,546,375	N25Y	probably damaging	Het
Eme2	G	A	17: 24,892,918	S263F	probably damaging	Het
Fam160b1	T	A	19: 57,372,926		probably benign	Het
Fgfrl1	T	A	5: 108,706,281		probably benign	Het
Gm3159	T	A	14: 4,398,586	Y92*	probably null	Het
Gm4922	T	A	10: 18,783,748	S409C	possibly damaging	Het
Gmcl1	G	A	6: 86,714,262		probably benign	Het
Grsf1	A	G	5: 88,665,847	Y231H	probably benign	Het
Heatr4	T	A	12: 83,967,621	H614L	possibly damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Isg20l2	C	A	3: 87,938,754	L325I	probably benign	Het
Kalrn	A	G	16: 34,212,820	Y879H	probably damaging	Het
Kcnk10	C	A	12: 98,436,226	W318L	probably damaging	Het
Kctd1	T	C	18: 15,062,597	E323G	possibly damaging	Het
Kif4	G	T	X: 100,689,097	A492S	probably benign	Het
Krtap4-1	T	C	11: 99,627,732	T151A	unknown	Het
Ldlr	A	T	9: 21,739,542	Q449L	probably benign	Het
Lepr	T	A	4: 101,792,019	D872E	probably damaging	Het
Lgals12	C	T	19: 7,603,957		probably benign	Het
Lrig3	C	T	10: 126,003,088	P488L	probably benign	Het
Lrrc4b	A	C	7: 44,462,452	I583L	probably benign	Het
Lyst	T	C	13: 13,740,536	S3272P	possibly damaging	Het
March2	T	C	17: 33,696,122	H166R	probably damaging	Het
Mtbp	C	A	15: 55,577,537	Y373*	probably null	Het
Myh2	C	T	11: 67,185,287	H767Y	probably benign	Het
Ncam1	G	A	9: 49,517,589		probably benign	Het
Neb	T	A	2: 52,289,646	N1282Y	probably damaging	Het
Nectin3	A	G	16: 46,448,756	Y428H	possibly damaging	Het
Nrros	A	T	16: 32,143,144	I649N	probably damaging	Het
Nvl	A	T	1: 181,097,126		probably benign	Het
Olfr495	T	A	7: 108,395,501	V127E	probably damaging	Het
Pms1	A	T	1: 53,207,276	V368E	possibly damaging	Het
Polq	T	A	16: 37,062,495	S1674T	possibly damaging	Het
Ppp1r21	T	C	17: 88,542,879	V31A	probably damaging	Het
Rev3l	T	A	10: 39,821,583	V692E	probably benign	Het
Robo4	T	C	9: 37,408,076		probably null	Het
Rps6kc1	T	C	1: 190,800,015	I597V	probably damaging	Het
Rtel1	T	A	2: 181,335,865		probably null	Het
Scn9a	A	G	2: 66,484,586	M1587T	probably benign	Het
Skint5	T	C	4: 113,779,071	N650S	unknown	Het
Slc22a28	G	T	19: 8,130,202	S167*	probably null	Het
Slfn1	T	A	11: 83,121,142	M28K	probably damaging	Het
Smc6	T	C	12: 11,271,879		probably benign	Het
Sox8	T	C	17: 25,567,883	H282R	probably benign	Het
Syngr3	C	A	17: 24,686,440	V161L	probably benign	Het
Trak1	C	T	9: 121,454,359	S397F	probably damaging	Het
Uso1	C	T	5: 92,181,468	A405V	probably benign	Het
Uvrag	G	T	7: 99,065,820	Y190*	probably null	Het
Vps13d	A	T	4: 145,099,983	L1726Q	probably null	Het
Vwf	A	T	6: 125,603,457	Q556L	probably benign	Het
Wdr70	T	A	15: 8,035,844	M246L	probably benign	Het
Yipf3	T	C	17: 46,251,446	F285S	probably damaging	Het
Zdhhc13	G	A	7: 48,826,873	G579R	probably damaging	Het
Zdhhc18	G	C	4: 133,627,297	F125L	probably benign	Het

Other mutations in Sec31b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Sec31b	APN	19	44527041	missense	probably damaging	1.00
IGL01308:Sec31b	APN	19	44523683	missense	probably benign	0.02
IGL02404:Sec31b	APN	19	44534788	missense	probably damaging	0.99
IGL02663:Sec31b	APN	19	44534278	missense	probably damaging	1.00
IGL02728:Sec31b	APN	19	44523115	missense	probably damaging	0.96
IGL02830:Sec31b	APN	19	44531703	missense	probably damaging	1.00
IGL03141:Sec31b	APN	19	44526320	splice site	probably benign
IGL03247:Sec31b	APN	19	44518940	missense	possibly damaging	0.62
R0049:Sec31b	UTSW	19	44520408	splice site	probably benign
R0137:Sec31b	UTSW	19	44534382	missense	probably damaging	1.00
R0238:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0239:Sec31b	UTSW	19	44525469	unclassified	probably benign
R0468:Sec31b	UTSW	19	44518508	splice site	probably benign
R0504:Sec31b	UTSW	19	44534786	missense	probably damaging	1.00
R0565:Sec31b	UTSW	19	44524553	missense	probably damaging	1.00
R0627:Sec31b	UTSW	19	44525607	missense	probably benign
R0749:Sec31b	UTSW	19	44524506	missense	probably damaging	0.96
R0815:Sec31b	UTSW	19	44518173	nonsense	probably null
R1162:Sec31b	UTSW	19	44517648	nonsense	probably null
R1436:Sec31b	UTSW	19	44536195	missense	probably damaging	0.99
R1538:Sec31b	UTSW	19	44518586	missense	probably benign	0.42
R1599:Sec31b	UTSW	19	44523153	missense	possibly damaging	0.92
R2044:Sec31b	UTSW	19	44536156	missense	probably benign	0.07
R2135:Sec31b	UTSW	19	44534696	missense	probably damaging	0.99
R2167:Sec31b	UTSW	19	44543353	missense	possibly damaging	0.89
R2211:Sec31b	UTSW	19	44523150	missense	probably damaging	1.00
R2938:Sec31b	UTSW	19	44536179	missense	probably damaging	0.99
R3113:Sec31b	UTSW	19	44518185	nonsense	probably null
R4110:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4111:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4113:Sec31b	UTSW	19	44524529	missense	possibly damaging	0.62
R4158:Sec31b	UTSW	19	44525186	missense	probably benign	0.34
R4226:Sec31b	UTSW	19	44531710	missense	probably benign
R4646:Sec31b	UTSW	19	44526621	missense	probably benign	0.00
R4732:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4733:Sec31b	UTSW	19	44532677	missense	probably damaging	1.00
R4795:Sec31b	UTSW	19	44531746	missense	probably benign	0.00
R4877:Sec31b	UTSW	19	44535733	missense	probably damaging	1.00
R5150:Sec31b	UTSW	19	44520531	missense	probably benign	0.08
R5377:Sec31b	UTSW	19	44518637	missense	probably damaging	1.00
R5381:Sec31b	UTSW	19	44534371	missense	probably damaging	1.00
R5708:Sec31b	UTSW	19	44523144	missense	probably damaging	1.00
R6002:Sec31b	UTSW	19	44535764	missense	probably benign	0.04
R6185:Sec31b	UTSW	19	44543284	missense	possibly damaging	0.77
R6675:Sec31b	UTSW	19	44523775	missense	probably benign
R6946:Sec31b	UTSW	19	44534316	missense	probably damaging	1.00
R7139:Sec31b	UTSW	19	44518936	missense	probably benign	0.00
R7237:Sec31b	UTSW	19	44517708	missense	probably damaging	1.00
R7270:Sec31b	UTSW	19	44523043	missense	probably benign	0.00
R7340:Sec31b	UTSW	19	44528722	missense	probably benign	0.00
R7505:Sec31b	UTSW	19	44543707	missense	probably damaging	1.00
R7584:Sec31b	UTSW	19	44543323	missense	probably damaging	0.99
R7584:Sec31b	UTSW	19	44531556	splice site	probably null
R7763:Sec31b	UTSW	19	44523835	critical splice acceptor site	probably null
R7777:Sec31b	UTSW	19	44523773	nonsense	probably null
R7900:Sec31b	UTSW	19	44526230	missense	probably damaging	1.00
R7952:Sec31b	UTSW	19	44520540	missense	probably benign	0.01
R8057:Sec31b	UTSW	19	44519365	missense	probably damaging	1.00
R8197:Sec31b	UTSW	19	44524516	missense	probably benign	0.25
R8739:Sec31b	UTSW	19	44519181	missense	probably benign	0.16
R8822:Sec31b	UTSW	19	44519263	missense	probably benign	0.02
R8837:Sec31b	UTSW	19	44517667	nonsense	probably null
R8916:Sec31b	UTSW	19	44532344	missense
RF023:Sec31b	UTSW	19	44535787	missense	probably damaging	1.00
Z1177:Sec31b	UTSW	19	44517314	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCCTGGAAAGCCTTCCTTCAC -3'
(R):5'- TGGATGCAGTCCATTGGTCCCAAC -3'

Sequencing Primer
(F):5'- gccttccttcacatcccc -3'
(R):5'- GGTCCCAACCTTAATAGCTTAAGGAG -3'

Posted On

2014-03-14