Mutagenetix > Incidental Mutation

Incidental Mutation 'R1399:Cep170'

160283

Institutional Source

Beutler Lab

Gene Symbol

Cep170

Ensembl Gene

ENSMUSG00000057335

Gene Name

centrosomal protein 170

Synonyms

A330004A13Rik, 4933426L22Rik

MMRRC Submission

039461-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.740) question?

Stock #

R1399 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

176561219-176641633 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 176585969 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 608 (E608K)

Ref Sequence

ENSEMBL: ENSMUSP00000141769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]

AlphaFold

Q6A065

Predicted Effect

probably damaging
Transcript: ENSMUST00000057037
AA Change: E608K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: E608K

Domain	Start	End	E-Value	Type
FHA	22	73	1.27e-7	SMART
low complexity region	118	133	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	738	750	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
Pfam:CEP170_C	801	1496	3.3e-264	PFAM
low complexity region	1533	1545	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000192664

Predicted Effect

probably benign
Transcript: ENSMUST00000192927

SMART Domains

Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Pfam:CEP170_C	30	469	3.4e-129	PFAM
Pfam:CEP170_C	449	708	7.4e-102	PFAM
low complexity region	742	754	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000194727
AA Change: E608K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: E608K

Domain	Start	End	E-Value	Type
FHA	22	73	1.27e-7	SMART
low complexity region	118	133	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	738	750	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
Pfam:CEP170_C	795	1509	8e-260	PFAM
low complexity region	1543	1555	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194984

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195121

Predicted Effect

probably benign
Transcript: ENSMUST00000195433

SMART Domains

Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

Domain	Start	End	E-Value	Type
FHA	22	73	6.1e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000195717
AA Change: E608K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: E608K

Domain	Start	End	E-Value	Type
FHA	22	73	1.27e-7	SMART
low complexity region	118	133	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	738	750	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
Pfam:CEP170_C	795	1499	1.8e-261	PFAM
low complexity region	1533	1545	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195463

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.1%
20x: 88.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	T	C	10: 80,177,042 (GRCm39)	S469G	probably damaging	Het
Ccdc168	G	A	1: 44,100,471 (GRCm39)	T209I	possibly damaging	Het
Csnk1g3	T	C	18: 54,028,982 (GRCm39)	V45A	probably damaging	Het
Eng	C	A	2: 32,563,334 (GRCm39)	Q297K	probably damaging	Het
Fcho1	C	T	8: 72,165,204 (GRCm39)	A418T	probably benign	Het
G6pd2	G	A	5: 61,967,361 (GRCm39)	D379N	probably benign	Het
Mrc1	C	T	2: 14,284,736 (GRCm39)	T575M	probably damaging	Het
Noct	C	T	3: 51,157,897 (GRCm39)		probably null	Het
Phka1	A	G	X: 101,660,964 (GRCm39)	S226P	probably damaging	Het
Pias4	T	C	10: 80,991,509 (GRCm39)	Y346C	probably damaging	Het
Ptger4	C	T	15: 5,264,412 (GRCm39)	E415K	possibly damaging	Het
Pwwp4b	A	G	X: 72,182,235 (GRCm39)	L287P	probably damaging	Het
Rb1cc1	G	A	1: 6,320,042 (GRCm39)	V1154I	probably benign	Het
Spopfm1	A	G	3: 94,173,102 (GRCm39)	M37V	probably benign	Het
Vmn2r121	A	C	X: 123,039,545 (GRCm39)	V541G	possibly damaging	Het
Zfp92	A	T	X: 72,466,401 (GRCm39)	T465S	probably benign	Het
Zfp92	A	G	X: 72,465,736 (GRCm39)	H243R	probably damaging	Het

Other mutations in Cep170

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Cep170	APN	1	176,582,965 (GRCm39)	missense	probably damaging	1.00
IGL00925:Cep170	APN	1	176,621,090 (GRCm39)	missense	probably damaging	1.00
IGL00972:Cep170	APN	1	176,563,262 (GRCm39)	missense	probably benign	0.00
IGL01488:Cep170	APN	1	176,583,941 (GRCm39)	missense	probably benign	0.00
IGL01916:Cep170	APN	1	176,567,476 (GRCm39)	splice site	probably benign
IGL02212:Cep170	APN	1	176,563,502 (GRCm39)	missense	probably damaging	0.99
IGL02269:Cep170	APN	1	176,596,932 (GRCm39)	missense	probably benign
IGL02732:Cep170	APN	1	176,564,440 (GRCm39)	missense	probably damaging	1.00
IGL02740:Cep170	APN	1	176,621,166 (GRCm39)	missense	probably damaging	1.00
IGL02812:Cep170	APN	1	176,570,080 (GRCm39)	missense	probably damaging	1.00
IGL03036:Cep170	APN	1	176,596,903 (GRCm39)	missense	possibly damaging	0.87
IGL03201:Cep170	APN	1	176,564,454 (GRCm39)	missense	probably damaging	1.00
IGL03333:Cep170	APN	1	176,597,092 (GRCm39)	missense	possibly damaging	0.64
BB003:Cep170	UTSW	1	176,588,979 (GRCm39)	missense	probably damaging	0.97
BB013:Cep170	UTSW	1	176,588,979 (GRCm39)	missense	probably damaging	0.97
PIT4520001:Cep170	UTSW	1	176,607,765 (GRCm39)	missense	unknown
R0031:Cep170	UTSW	1	176,583,657 (GRCm39)	missense	probably damaging	1.00
R0039:Cep170	UTSW	1	176,610,061 (GRCm39)	critical splice donor site	probably null
R0053:Cep170	UTSW	1	176,609,946 (GRCm39)	missense	possibly damaging	0.82
R0053:Cep170	UTSW	1	176,609,946 (GRCm39)	missense	possibly damaging	0.82
R0113:Cep170	UTSW	1	176,586,021 (GRCm39)	missense	probably damaging	0.97
R0144:Cep170	UTSW	1	176,620,161 (GRCm39)	missense	probably benign	0.01
R0613:Cep170	UTSW	1	176,602,246 (GRCm39)	missense	probably benign
R0755:Cep170	UTSW	1	176,583,319 (GRCm39)	missense	probably damaging	1.00
R1132:Cep170	UTSW	1	176,577,603 (GRCm39)	missense	probably damaging	1.00
R1367:Cep170	UTSW	1	176,563,290 (GRCm39)	missense	probably damaging	0.99
R1462:Cep170	UTSW	1	176,584,211 (GRCm39)	missense	possibly damaging	0.46
R1462:Cep170	UTSW	1	176,584,211 (GRCm39)	missense	possibly damaging	0.46
R1481:Cep170	UTSW	1	176,609,951 (GRCm39)	missense	possibly damaging	0.56
R1526:Cep170	UTSW	1	176,616,071 (GRCm39)	missense	probably damaging	1.00
R1540:Cep170	UTSW	1	176,567,498 (GRCm39)	missense	probably damaging	1.00
R1552:Cep170	UTSW	1	176,610,060 (GRCm39)	splice site	probably benign
R1570:Cep170	UTSW	1	176,583,367 (GRCm39)	missense	possibly damaging	0.64
R1846:Cep170	UTSW	1	176,583,335 (GRCm39)	missense	probably damaging	1.00
R1884:Cep170	UTSW	1	176,602,245 (GRCm39)	missense	probably benign	0.12
R1945:Cep170	UTSW	1	176,621,100 (GRCm39)	nonsense	probably null
R1954:Cep170	UTSW	1	176,583,950 (GRCm39)	missense	probably benign
R1957:Cep170	UTSW	1	176,597,013 (GRCm39)	missense	probably benign	0.24
R2184:Cep170	UTSW	1	176,584,542 (GRCm39)	missense	probably benign	0.00
R2280:Cep170	UTSW	1	176,602,071 (GRCm39)	missense	probably benign	0.17
R2426:Cep170	UTSW	1	176,602,201 (GRCm39)	missense	probably benign
R3415:Cep170	UTSW	1	176,583,610 (GRCm39)	missense	probably damaging	1.00
R3417:Cep170	UTSW	1	176,583,610 (GRCm39)	missense	probably damaging	1.00
R3752:Cep170	UTSW	1	176,610,061 (GRCm39)	critical splice donor site	probably benign
R3848:Cep170	UTSW	1	176,583,409 (GRCm39)	missense	probably benign	0.14
R3849:Cep170	UTSW	1	176,583,409 (GRCm39)	missense	probably benign	0.14
R4752:Cep170	UTSW	1	176,584,254 (GRCm39)	missense	probably benign	0.00
R4910:Cep170	UTSW	1	176,609,829 (GRCm39)	missense	possibly damaging	0.94
R5007:Cep170	UTSW	1	176,597,380 (GRCm39)	missense	probably benign	0.28
R5052:Cep170	UTSW	1	176,621,117 (GRCm39)	missense	probably damaging	1.00
R5093:Cep170	UTSW	1	176,596,896 (GRCm39)	missense	possibly damaging	0.95
R5530:Cep170	UTSW	1	176,597,076 (GRCm39)	missense	probably benign	0.00
R5622:Cep170	UTSW	1	176,563,433 (GRCm39)	missense	possibly damaging	0.64
R5892:Cep170	UTSW	1	176,582,953 (GRCm39)	splice site	probably null
R5942:Cep170	UTSW	1	176,583,985 (GRCm39)	missense	probably damaging	1.00
R6083:Cep170	UTSW	1	176,602,191 (GRCm39)	missense	probably damaging	1.00
R6091:Cep170	UTSW	1	176,583,397 (GRCm39)	missense	probably damaging	0.98
R6190:Cep170	UTSW	1	176,609,975 (GRCm39)	missense	probably damaging	1.00
R6253:Cep170	UTSW	1	176,607,960 (GRCm39)	missense	possibly damaging	0.71
R6476:Cep170	UTSW	1	176,607,917 (GRCm39)	missense	possibly damaging	0.72
R6622:Cep170	UTSW	1	176,583,898 (GRCm39)	missense	probably damaging	1.00
R6932:Cep170	UTSW	1	176,589,003 (GRCm39)	missense	possibly damaging	0.90
R7030:Cep170	UTSW	1	176,584,051 (GRCm39)	missense	probably damaging	0.99
R7163:Cep170	UTSW	1	176,602,031 (GRCm39)	missense	probably damaging	1.00
R7352:Cep170	UTSW	1	176,597,423 (GRCm39)	missense	probably benign	0.11
R7499:Cep170	UTSW	1	176,602,028 (GRCm39)	missense	probably damaging	1.00
R7502:Cep170	UTSW	1	176,583,595 (GRCm39)	missense	probably damaging	1.00
R7773:Cep170	UTSW	1	176,567,642 (GRCm39)	missense
R7926:Cep170	UTSW	1	176,588,979 (GRCm39)	missense	probably damaging	0.97
R8043:Cep170	UTSW	1	176,596,808 (GRCm39)	missense	probably damaging	0.96
R8203:Cep170	UTSW	1	176,596,877 (GRCm39)	missense	probably benign	0.28
R8350:Cep170	UTSW	1	176,564,445 (GRCm39)	missense
R8450:Cep170	UTSW	1	176,564,445 (GRCm39)	missense
R8835:Cep170	UTSW	1	176,584,429 (GRCm39)	missense	probably benign	0.00
R8931:Cep170	UTSW	1	176,597,377 (GRCm39)	missense	probably benign	0.02
R9108:Cep170	UTSW	1	176,616,051 (GRCm39)	nonsense	probably null
R9323:Cep170	UTSW	1	176,586,068 (GRCm39)	missense	probably benign
R9586:Cep170	UTSW	1	176,563,463 (GRCm39)	missense	possibly damaging	0.88
R9629:Cep170	UTSW	1	176,583,821 (GRCm39)	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- GGTTAGGTGGCATAGCATAGCATCTTG -3'
(R):5'- GCTGTGACTGAATGAAGTTCTCGCTC -3'

Sequencing Primer
(F):5'- ACACTAGTCCTCAGTTTACTTCAT -3'
(R):5'- CTCATGAAAATGAGCATTGGCAG -3'

Posted On

2014-03-14