Incidental Mutation 'R1399:Noct'
ID160286
Institutional Source Beutler Lab
Gene Symbol Noct
Ensembl Gene ENSMUSG00000023087
Gene Namenocturnin
SynonymsCcrn4l, Ccr4
MMRRC Submission 039461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1399 (G1)
Quality Score176
Status Not validated
Chromosome3
Chromosomal Location51224447-51251644 bp(+) (GRCm38)
Type of Mutationunclassified (2244 bp from exon)
DNA Base Change (assembly) C to T at 51250476 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023849] [ENSMUST00000062009] [ENSMUST00000144826] [ENSMUST00000167780] [ENSMUST00000183463] [ENSMUST00000193018] [ENSMUST00000194641]
Predicted Effect probably damaging
Transcript: ENSMUST00000023849
AA Change: H412Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023849
Gene: ENSMUSG00000023087
AA Change: H412Y

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 3.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000062009
SMART Domains Protein: ENSMUSP00000061076
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 2.2e-37 PFAM
low complexity region 130 142 N/A INTRINSIC
low complexity region 160 169 N/A INTRINSIC
ETS 195 282 1.28e-51 SMART
low complexity region 357 379 N/A INTRINSIC
low complexity region 411 421 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144826
AA Change: H348Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141416
Gene: ENSMUSG00000023087
AA Change: H348Y

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 80 348 6.7e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167780
AA Change: H412Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130347
Gene: ENSMUSG00000023087
AA Change: H412Y

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 5.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183463
SMART Domains Protein: ENSMUSP00000139360
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 85 2.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193018
SMART Domains Protein: ENSMUSP00000142216
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
SCOP:d1hd7a_ 52 84 4e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000194641
SMART Domains Protein: ENSMUSP00000141197
Gene: ENSMUSG00000037174

DomainStartEndE-ValueType
Pfam:Elf-1_N 2 108 1.2e-37 PFAM
low complexity region 142 154 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
ETS 207 294 1.28e-51 SMART
low complexity region 369 391 N/A INTRINSIC
low complexity region 423 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are resistant to diet-induced obesity and fatty liver development, show increased circulating glucose levels and increased insulin sensitivity on a standard diet and have impaired glucose tolerance on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 T C 10: 80,341,208 S469G probably damaging Het
Cep170 C T 1: 176,758,403 E608K probably damaging Het
Csnk1g3 T C 18: 53,895,910 V45A probably damaging Het
DXBay18 A G X: 73,138,629 L287P probably damaging Het
Eng C A 2: 32,673,322 Q297K probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
G6pd2 G A 5: 61,810,018 D379N probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Gm8251 G A 1: 44,061,311 T209I possibly damaging Het
Mrc1 C T 2: 14,279,925 T575M probably damaging Het
Phka1 A G X: 102,617,358 S226P probably damaging Het
Pias4 T C 10: 81,155,675 Y346C probably damaging Het
Ptger4 C T 15: 5,234,931 E415K possibly damaging Het
Rb1cc1 G A 1: 6,249,818 V1154I probably benign Het
Vmn2r121 A C X: 124,129,848 V541G possibly damaging Het
Zfp92 A G X: 73,422,130 H243R probably damaging Het
Zfp92 A T X: 73,422,795 T465S probably benign Het
Other mutations in Noct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Noct APN 3 51248048 missense probably damaging 0.99
R0256:Noct UTSW 3 51250474 missense probably damaging 1.00
R1539:Noct UTSW 3 51247912 nonsense probably null
R1618:Noct UTSW 3 51247830 missense probably damaging 1.00
R2001:Noct UTSW 3 51248044 missense probably damaging 1.00
R2176:Noct UTSW 3 51249696 critical splice acceptor site probably null
R2408:Noct UTSW 3 51225289 critical splice donor site probably null
R4413:Noct UTSW 3 51250335 missense probably damaging 1.00
R4552:Noct UTSW 3 51250168 missense probably benign 0.16
R4690:Noct UTSW 3 51247879 nonsense probably null
R4993:Noct UTSW 3 51250021 missense probably damaging 1.00
R5009:Noct UTSW 3 51248061 missense probably damaging 1.00
R6467:Noct UTSW 3 51250087 missense possibly damaging 0.90
R6631:Noct UTSW 3 51250200 missense probably damaging 1.00
R7454:Noct UTSW 3 51249730 missense probably damaging 1.00
R7467:Noct UTSW 3 51225201 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTGCTGTCACCCACTTAAAAGCC -3'
(R):5'- AGTGCAAACACCTTTTCAATGCGG -3'

Sequencing Primer
(F):5'- GAGGTCTACAAACACTTTGCGTC -3'
(R):5'- ACACCTTTTCAATGCGGGTTTTAG -3'
Posted On2014-03-14