Incidental Mutation 'R1399:G6pd2'
ID160288
Institutional Source Beutler Lab
Gene Symbol G6pd2
Ensembl Gene ENSMUSG00000089992
Gene Nameglucose-6-phosphate dehydrogenase 2
SynonymsGpd2, Gpd-2, G6pdx-ps1
MMRRC Submission 039461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1399 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location61808816-61811163 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61810018 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 379 (D379N)
Ref Sequence ENSEMBL: ENSMUSP00000131163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053876]
Predicted Effect probably benign
Transcript: ENSMUST00000053876
AA Change: D379N

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000131163
Gene: ENSMUSG00000089992
AA Change: D379N

DomainStartEndE-ValueType
Pfam:G6PD_N 35 210 4.1e-60 PFAM
Pfam:G6PD_C 212 504 9.9e-119 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 T C 10: 80,341,208 S469G probably damaging Het
Cep170 C T 1: 176,758,403 E608K probably damaging Het
Csnk1g3 T C 18: 53,895,910 V45A probably damaging Het
DXBay18 A G X: 73,138,629 L287P probably damaging Het
Eng C A 2: 32,673,322 Q297K probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Gm8251 G A 1: 44,061,311 T209I possibly damaging Het
Mrc1 C T 2: 14,279,925 T575M probably damaging Het
Noct C T 3: 51,250,476 probably null Het
Phka1 A G X: 102,617,358 S226P probably damaging Het
Pias4 T C 10: 81,155,675 Y346C probably damaging Het
Ptger4 C T 15: 5,234,931 E415K possibly damaging Het
Rb1cc1 G A 1: 6,249,818 V1154I probably benign Het
Vmn2r121 A C X: 124,129,848 V541G possibly damaging Het
Zfp92 A G X: 73,422,130 H243R probably damaging Het
Zfp92 A T X: 73,422,795 T465S probably benign Het
Other mutations in G6pd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:G6pd2 APN 5 61810063 missense probably benign
IGL01329:G6pd2 APN 5 61809938 missense probably damaging 1.00
IGL02072:G6pd2 APN 5 61809410 missense probably damaging 1.00
IGL02502:G6pd2 APN 5 61809628 missense probably damaging 1.00
IGL02800:G6pd2 APN 5 61809392 missense probably damaging 1.00
IGL03012:G6pd2 APN 5 61809473 missense probably damaging 1.00
IGL03085:G6pd2 APN 5 61810302 missense probably benign
R0505:G6pd2 UTSW 5 61809567 missense probably benign
R0632:G6pd2 UTSW 5 61810171 missense probably benign
R0658:G6pd2 UTSW 5 61809674 missense probably damaging 1.00
R1918:G6pd2 UTSW 5 61810321 missense probably benign
R2077:G6pd2 UTSW 5 61810251 missense probably damaging 0.97
R2338:G6pd2 UTSW 5 61810008 missense probably benign
R2566:G6pd2 UTSW 5 61808987 missense probably damaging 1.00
R2918:G6pd2 UTSW 5 61809526 missense probably damaging 1.00
R3963:G6pd2 UTSW 5 61808885 start codon destroyed probably null 0.50
R4399:G6pd2 UTSW 5 61810173 missense probably benign 0.01
R4469:G6pd2 UTSW 5 61808945 missense probably benign
R4560:G6pd2 UTSW 5 61810343 missense possibly damaging 0.95
R4563:G6pd2 UTSW 5 61810343 missense possibly damaging 0.95
R4914:G6pd2 UTSW 5 61810329 nonsense probably null
R5106:G6pd2 UTSW 5 61810352 missense probably benign
R5242:G6pd2 UTSW 5 61809442 missense probably benign 0.00
R5838:G6pd2 UTSW 5 61809225 missense probably benign
R6131:G6pd2 UTSW 5 61809250 missense probably benign 0.03
R6200:G6pd2 UTSW 5 61809871 missense probably benign 0.00
R7009:G6pd2 UTSW 5 61808891 missense probably benign 0.00
R7337:G6pd2 UTSW 5 61810219 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGAAAAGCCTGCTACCACAGATTC -3'
(R):5'- GACATCCAGGATGAGGCGTTCATAG -3'

Sequencing Primer
(F):5'- ACTGACAATGTGATCCTTGGC -3'
(R):5'- ATGAGGCGTTCATAGGCACC -3'
Posted On2014-03-14