Incidental Mutation 'R1399:Fcho1'
ID 160289
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene Name FCH domain only 1
Synonyms 3322402E17Rik
MMRRC Submission 039461-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock # R1399 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 71708387-71725716 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 71712560 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 418 (A418T)
Ref Sequence ENSEMBL: ENSMUSP00000117606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
AlphaFold Q8K285
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: A418T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: A418T

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152742
Predicted Effect probably benign
Transcript: ENSMUST00000153800
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 T C 10: 80,341,208 S469G probably damaging Het
Cep170 C T 1: 176,758,403 E608K probably damaging Het
Csnk1g3 T C 18: 53,895,910 V45A probably damaging Het
DXBay18 A G X: 73,138,629 L287P probably damaging Het
Eng C A 2: 32,673,322 Q297K probably damaging Het
G6pd2 G A 5: 61,810,018 D379N probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Gm8251 G A 1: 44,061,311 T209I possibly damaging Het
Mrc1 C T 2: 14,279,925 T575M probably damaging Het
Noct C T 3: 51,250,476 probably null Het
Phka1 A G X: 102,617,358 S226P probably damaging Het
Pias4 T C 10: 81,155,675 Y346C probably damaging Het
Ptger4 C T 15: 5,234,931 E415K possibly damaging Het
Rb1cc1 G A 1: 6,249,818 V1154I probably benign Het
Vmn2r121 A C X: 124,129,848 V541G possibly damaging Het
Zfp92 A G X: 73,422,130 H243R probably damaging Het
Zfp92 A T X: 73,422,795 T465S probably benign Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
cameo UTSW 8 71716863 missense possibly damaging 0.92
Lesser UTSW 8 71712560 missense probably benign 0.00
Sidekick UTSW 8 71715725 missense probably damaging 1.00
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5083:Fcho1 UTSW 8 71717176 missense probably benign 0.00
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 splice site probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
R7951:Fcho1 UTSW 8 71712276 missense probably benign 0.00
R8699:Fcho1 UTSW 8 71709633 missense possibly damaging 0.63
R8938:Fcho1 UTSW 8 71717146 missense possibly damaging 0.96
R9090:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9117:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9119:Fcho1 UTSW 8 71712068 missense possibly damaging 0.87
R9271:Fcho1 UTSW 8 71710424 missense possibly damaging 0.80
R9433:Fcho1 UTSW 8 71716824 missense probably benign 0.03
R9447:Fcho1 UTSW 8 71717269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGTTGTCACCGCCAATGTC -3'
(R):5'- GTCAAAATTCTGGATGCGCGGATG -3'

Sequencing Primer
(F):5'- ACCGCCAATGTCCGCAG -3'
(R):5'- GATGCGCGGATGAGTGG -3'
Posted On 2014-03-14