Incidental Mutation 'R1399:Pias4'
ID160291
Institutional Source Beutler Lab
Gene Symbol Pias4
Ensembl Gene ENSMUSG00000004934
Gene Nameprotein inhibitor of activated STAT 4
SynonymsPIASy
MMRRC Submission 039461-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.874) question?
Stock #R1399 (G1)
Quality Score203
Status Not validated
Chromosome10
Chromosomal Location81153266-81167923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81155675 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 346 (Y346C)
Ref Sequence ENSEMBL: ENSMUSP00000005064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005064] [ENSMUST00000048128] [ENSMUST00000121840] [ENSMUST00000135765]
Predicted Effect probably damaging
Transcript: ENSMUST00000005064
AA Change: Y346C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005064
Gene: ENSMUSG00000004934
AA Change: Y346C

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 123 270 9.6e-35 PFAM
Pfam:zf-MIZ 315 364 2.4e-24 PFAM
low complexity region 429 454 N/A INTRINSIC
low complexity region 469 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048128
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121840
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134017
Predicted Effect probably benign
Transcript: ENSMUST00000135765
SMART Domains Protein: ENSMUSP00000121361
Gene: ENSMUSG00000004934

DomainStartEndE-ValueType
PDB:4FO9|A 1 70 9e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147436
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants display mild postnatal lethality or a normal phenotype depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 T C 10: 80,341,208 S469G probably damaging Het
Cep170 C T 1: 176,758,403 E608K probably damaging Het
Csnk1g3 T C 18: 53,895,910 V45A probably damaging Het
DXBay18 A G X: 73,138,629 L287P probably damaging Het
Eng C A 2: 32,673,322 Q297K probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
G6pd2 G A 5: 61,810,018 D379N probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Gm8251 G A 1: 44,061,311 T209I possibly damaging Het
Mrc1 C T 2: 14,279,925 T575M probably damaging Het
Noct C T 3: 51,250,476 probably null Het
Phka1 A G X: 102,617,358 S226P probably damaging Het
Ptger4 C T 15: 5,234,931 E415K possibly damaging Het
Rb1cc1 G A 1: 6,249,818 V1154I probably benign Het
Vmn2r121 A C X: 124,129,848 V541G possibly damaging Het
Zfp92 A G X: 73,422,130 H243R probably damaging Het
Zfp92 A T X: 73,422,795 T465S probably benign Het
Other mutations in Pias4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Pias4 APN 10 81155658 missense probably benign 0.07
IGL01790:Pias4 APN 10 81157498 missense probably damaging 0.98
IGL02553:Pias4 APN 10 81163787 missense probably damaging 1.00
IGL02670:Pias4 APN 10 81164070 missense probably damaging 0.99
petrified_forest UTSW 10 81155855 missense probably damaging 1.00
R0083:Pias4 UTSW 10 81164166 missense probably damaging 1.00
R0122:Pias4 UTSW 10 81157087 missense probably damaging 0.96
R0711:Pias4 UTSW 10 81157530 unclassified probably benign
R1726:Pias4 UTSW 10 81155855 missense probably damaging 1.00
R1907:Pias4 UTSW 10 81154363 missense possibly damaging 0.46
R3730:Pias4 UTSW 10 81164054 missense probably damaging 0.98
R4764:Pias4 UTSW 10 81164034 missense possibly damaging 0.88
R4790:Pias4 UTSW 10 81157492 missense probably damaging 0.98
R4808:Pias4 UTSW 10 81155840 unclassified probably null
R6351:Pias4 UTSW 10 81157264 missense probably damaging 1.00
R6786:Pias4 UTSW 10 81157246 missense probably damaging 1.00
R7113:Pias4 UTSW 10 81154453 missense possibly damaging 0.94
R7260:Pias4 UTSW 10 81157468 missense possibly damaging 0.95
R7487:Pias4 UTSW 10 81163972 missense probably benign
R7609:Pias4 UTSW 10 81158026 splice site probably null
R8224:Pias4 UTSW 10 81167731 start gained probably benign
R8387:Pias4 UTSW 10 81154508 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATAGCAAAGGCCCCAGTAATC -3'
(R):5'- GTCACCTCACACAGTCAAGGAGAAG -3'

Sequencing Primer
(F):5'- CCAGACTGCGTGCTTAGAATG -3'
(R):5'- AGTGCGAGTGTCCCTCATC -3'
Posted On2014-03-14