Incidental Mutation 'R1399:Phka1'
ID160298
Institutional Source Beutler Lab
Gene Symbol Phka1
Ensembl Gene ENSMUSG00000034055
Gene Namephosphorylase kinase alpha 1
Synonyms9830108K24Rik, Phka
MMRRC Submission 039461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1399 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location102513975-102644246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102617358 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 226 (S226P)
Ref Sequence ENSEMBL: ENSMUSP00000113302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043596] [ENSMUST00000052012] [ENSMUST00000113611] [ENSMUST00000119229] [ENSMUST00000120270] [ENSMUST00000122022]
Predicted Effect probably damaging
Transcript: ENSMUST00000043596
AA Change: S226P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042778
Gene: ENSMUSG00000034055
AA Change: S226P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 864 5.6e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052012
AA Change: S226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061991
Gene: ENSMUSG00000034055
AA Change: S226P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.8e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113611
AA Change: S226P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109241
Gene: ENSMUSG00000034055
AA Change: S226P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.5e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119229
AA Change: S226P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114066
Gene: ENSMUSG00000034055
AA Change: S226P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120270
AA Change: S226P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113302
Gene: ENSMUSG00000034055
AA Change: S226P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.3e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122022
AA Change: S226P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112529
Gene: ENSMUSG00000034055
AA Change: S226P

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.6e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142534
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the skeletal muscle isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9D, also known as X-linked muscle glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. A pseudogene has been found on chromosome 1.[provided by RefSeq, Feb 2010]
PHENOTYPE: PHK activity is nearly absent in I/Ln skeletal muscle and reduced in brain, heart and kidney. The I-allele sequence is known to have a single nucleotide insertion (frameshift). A different allele in strain V reduces PHK activity to 25% and is dominant tonormal and I-strain alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 T C 10: 80,341,208 S469G probably damaging Het
Cep170 C T 1: 176,758,403 E608K probably damaging Het
Csnk1g3 T C 18: 53,895,910 V45A probably damaging Het
DXBay18 A G X: 73,138,629 L287P probably damaging Het
Eng C A 2: 32,673,322 Q297K probably damaging Het
Fcho1 C T 8: 71,712,560 A418T probably benign Het
G6pd2 G A 5: 61,810,018 D379N probably benign Het
Gm4778 A G 3: 94,265,795 M37V probably benign Het
Gm8251 G A 1: 44,061,311 T209I possibly damaging Het
Mrc1 C T 2: 14,279,925 T575M probably damaging Het
Noct C T 3: 51,250,476 probably null Het
Pias4 T C 10: 81,155,675 Y346C probably damaging Het
Ptger4 C T 15: 5,234,931 E415K possibly damaging Het
Rb1cc1 G A 1: 6,249,818 V1154I probably benign Het
Vmn2r121 A C X: 124,129,848 V541G possibly damaging Het
Zfp92 A G X: 73,422,130 H243R probably damaging Het
Zfp92 A T X: 73,422,795 T465S probably benign Het
Other mutations in Phka1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Phka1 APN X 102586106 missense probably damaging 0.99
IGL02561:Phka1 APN X 102598289 splice site probably benign
IGL03201:Phka1 APN X 102541110 critical splice donor site probably null
IGL03294:Phka1 APN X 102537213 missense probably damaging 1.00
R0626:Phka1 UTSW X 102520831 missense probably damaging 1.00
R0635:Phka1 UTSW X 102621400 missense probably damaging 1.00
R0709:Phka1 UTSW X 102586104 missense probably damaging 0.98
R2114:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2115:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2117:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2267:Phka1 UTSW X 102541110 critical splice donor site probably benign
R2268:Phka1 UTSW X 102541110 critical splice donor site probably benign
R4463:Phka1 UTSW X 102545384 missense probably benign
X0022:Phka1 UTSW X 102621345 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACAAAAGCTCTCCCTGCTTC -3'
(R):5'- GCAAAGTGCAAATCCCAAGCTCC -3'

Sequencing Primer
(F):5'- ctcacctacctctcaagcac -3'
(R):5'- AGCATGTGTTCTGCCACT -3'
Posted On2014-03-14