Incidental Mutation 'R1400:Crygd'
ID160302
Institutional Source Beutler Lab
Gene Symbol Crygd
Ensembl Gene ENSMUSG00000067299
Gene Namecrystallin, gamma D
SynonymsCryg-1, DGcry-1, Aey4
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location65061872-65063452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65063208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 32 (S32P)
Ref Sequence ENSEMBL: ENSMUSP00000122528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045028] [ENSMUST00000146122]
Predicted Effect probably damaging
Transcript: ENSMUST00000045028
AA Change: S35P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045327
Gene: ENSMUSG00000067299
AA Change: S35P

DomainStartEndE-ValueType
XTALbg 3 82 3.23e-45 SMART
XTALbg 89 170 4.09e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127762
Predicted Effect probably damaging
Transcript: ENSMUST00000146122
AA Change: S32P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122528
Gene: ENSMUSG00000067299
AA Change: S32P

DomainStartEndE-ValueType
XTALbg 1 79 1.77e-42 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes for a spontaneous mutation exhibit a dense nuclear cataract and mild microphthalmia by 2-months of age, followed by posterior capsular rupture into the posterior vitreous by 3-months. In homozygotes, the microphthalmia is more pronounced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Krt13 C A 11: 100,121,284 G71V probably damaging Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Crygd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Crygd APN 1 65062091 missense probably benign 0.32
IGL00640:Crygd APN 1 65062091 missense probably benign 0.32
IGL00650:Crygd APN 1 65062091 missense probably benign 0.32
IGL00654:Crygd APN 1 65062091 missense probably benign 0.32
IGL00732:Crygd APN 1 65062091 missense probably benign 0.32
IGL00755:Crygd APN 1 65062091 missense probably benign 0.32
IGL00772:Crygd APN 1 65062091 missense probably benign 0.32
IGL00788:Crygd APN 1 65062091 missense probably benign 0.32
IGL00852:Crygd APN 1 65062091 missense probably benign 0.32
IGL00861:Crygd APN 1 65062091 missense probably benign 0.32
IGL00863:Crygd APN 1 65062091 missense probably benign 0.32
IGL00864:Crygd APN 1 65062091 missense probably benign 0.32
IGL00885:Crygd APN 1 65062091 missense probably benign 0.32
IGL00886:Crygd APN 1 65062091 missense probably benign 0.32
IGL01939:Crygd APN 1 65062026 missense probably benign
L23 UTSW 1 65063084 missense probably damaging 1.00
R1528:Crygd UTSW 1 65063057 critical splice donor site probably null
R1862:Crygd UTSW 1 65061974 missense probably benign 0.03
R2077:Crygd UTSW 1 65063246 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCTCAGCTCTGCTTTCAAC -3'
(R):5'- GGCATCCTCATTTTGGGAAGGGAC -3'

Sequencing Primer
(F):5'- AGGGTCTTCAGTGCCTCAG -3'
(R):5'- ATTTTGGGAAGGGACCTGCC -3'
Posted On2014-03-14