Mutagenetix > Incidental Mutation

Incidental Mutation 'R1400:Slc5a5'

160329

Institutional Source

Beutler Lab

Gene Symbol

Slc5a5

Ensembl Gene

ENSMUSG00000000792

Gene Name

solute carrier family 5 (sodium iodide symporter), member 5

Synonyms

NIS

MMRRC Submission

039462-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1400 (G1)

Quality Score

192

Status

Not validated

Chromosome

Chromosomal Location

70882889-70892757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70889435 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 292 (I292V)

Ref Sequence

ENSEMBL: ENSMUSP00000000809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000809]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000809
AA Change: I292V

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000000809
Gene: ENSMUSG00000000792
AA Change: I292V

Domain	Start	End	E-Value	Type
Pfam:SSF	47	452	2.5e-43	PFAM
transmembrane domain	522	544	N/A	INTRINSIC

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family. The encoded protein is responsible for the uptake of iodine in tissues such as the thyroid and lactating breast tissue. The iodine taken up by the thyroid is incorporated into the metabolic regulators triiodothyronine (T3) and tetraiodothyronine (T4). Mutations in this gene are associated with thyroid dyshormonogenesis 1.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced T3 and T4 levels when fed a minimal iodine diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700057G04Rik	G	T	9: 92,351,127	C25F	probably benign	Het
9130008F23Rik	T	C	17: 40,880,304	E78G	probably damaging	Het
Acsf2	T	C	11: 94,570,316	I345V	probably benign	Het
Akap11	T	A	14: 78,513,962	K328N	probably damaging	Het
Aoc1	T	A	6: 48,906,283	Y364*	probably null	Het
Aoc1	A	T	6: 48,906,711	Q507L	probably benign	Het
Atp6v1c2	T	C	12: 17,289,130	T207A	probably benign	Het
Atr	C	A	9: 95,862,848	Q73K	probably benign	Het
Cage1	A	G	13: 38,032,424	S17P	possibly damaging	Het
Cfap44	A	T	16: 44,421,212	I649F	probably benign	Het
Cops4	A	G	5: 100,533,546	K200R	probably damaging	Het
Crygd	A	G	1: 65,063,208	S32P	probably damaging	Het
Cyp3a11	A	G	5: 145,862,489	I296T	probably damaging	Het
Fads3	A	G	19: 10,056,300		probably null	Het
Fbn2	T	C	18: 58,080,193	E974G	possibly damaging	Het
Gcgr	A	G	11: 120,534,986	H45R	probably benign	Het
Gcn1l1	T	C	5: 115,614,161	I2112T	probably damaging	Het
Gm43302	A	T	5: 105,274,756	I470N	probably damaging	Het
Hoxa13	C	G	6: 52,260,647		probably benign	Het
Hoxa13	G	C	6: 52,260,648		probably benign	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Krt13	C	A	11: 100,121,284	G71V	probably damaging	Het
Las1l	T	C	X: 95,946,900	T390A	possibly damaging	Het
Lifr	T	A	15: 7,190,865	V992E	probably benign	Het
Mbd5	T	C	2: 49,274,776		probably null	Het
Mzf1	C	A	7: 13,052,771	R124L	possibly damaging	Het
Ndst3	A	G	3: 123,556,828	F636S	probably damaging	Het
Necab1	T	C	4: 14,975,185	D232G	possibly damaging	Het
Nlrp4e	A	T	7: 23,321,660	E524V	possibly damaging	Het
Nxf3	T	A	X: 136,076,045	T349S	probably benign	Het
Ofcc1	C	T	13: 40,208,829	G206R	probably benign	Het
Olfr1013	T	C	2: 85,770,133	C111R	possibly damaging	Het
Olfr1259	T	A	2: 89,943,542	H191L	possibly damaging	Het
Olfr722	A	T	14: 49,895,691	I37K	possibly damaging	Het
Olfr847	A	G	9: 19,375,062	V273A	probably damaging	Het
Ppm1e	T	A	11: 87,231,766	N455I	probably damaging	Het
Prkag2	G	A	5: 24,873,918	T158I	probably damaging	Het
Ptpn18	T	C	1: 34,463,506		probably null	Het
Rai14	T	G	15: 10,571,548	K936N	probably damaging	Het
Rasgrf2	A	G	13: 91,887,689	L1077P	probably damaging	Het
Rgn	C	A	X: 20,550,457	Q27K	probably benign	Het
Ryr2	C	T	13: 11,595,076	S723N	probably benign	Het
Scamp1	A	G	13: 94,224,947	F142L	possibly damaging	Het
Selenon	A	G	4: 134,551,518	V67A	probably benign	Het
Smarca2	C	A	19: 26,676,740	T775K	probably damaging	Het
Stab1	C	T	14: 31,139,830	V2437I	possibly damaging	Het
Tas2r143	C	T	6: 42,400,383	A49V	probably benign	Het
Tlr7	T	A	X: 167,307,849	N214Y	probably damaging	Het
Unc13a	C	A	8: 71,651,221	D856Y	probably damaging	Het
Upp2	T	C	2: 58,790,106	Y263H	probably damaging	Het
Vill	T	C	9: 119,063,347	S349P	probably benign	Het
Zfp644	T	C	5: 106,637,470		probably null	Het
Zfp664	T	C	5: 124,886,153	C204R	unknown	Het
Zfp729b	A	G	13: 67,592,794	Y451H	possibly damaging	Het

Other mutations in Slc5a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Slc5a5	APN	8	70888537	missense	probably damaging	0.99
IGL01372:Slc5a5	APN	8	70890376	unclassified	probably benign
IGL01394:Slc5a5	APN	8	70889388	nonsense	probably null
IGL01571:Slc5a5	APN	8	70891332	unclassified	probably benign
IGL02043:Slc5a5	APN	8	70892429	missense	possibly damaging	0.84
IGL02186:Slc5a5	APN	8	70886120	missense	possibly damaging	0.79
IGL02479:Slc5a5	APN	8	70888911	missense	possibly damaging	0.67
IGL02559:Slc5a5	APN	8	70890271	missense	probably damaging	1.00
IGL02892:Slc5a5	APN	8	70892517	missense	probably damaging	1.00
IGL03388:Slc5a5	APN	8	70890328	missense	probably benign	0.45
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0234:Slc5a5	UTSW	8	70889633	missense	probably damaging	1.00
R0413:Slc5a5	UTSW	8	70891675	missense	possibly damaging	0.63
R0662:Slc5a5	UTSW	8	70883875	missense	probably benign	0.01
R0781:Slc5a5	UTSW	8	70890220	missense	probably benign	0.19
R1061:Slc5a5	UTSW	8	70890221	missense	probably benign	0.00
R1524:Slc5a5	UTSW	8	70892334	missense	probably damaging	1.00
R2033:Slc5a5	UTSW	8	70888587	missense	probably damaging	0.99
R2072:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2075:Slc5a5	UTSW	8	70892439	missense	possibly damaging	0.95
R2110:Slc5a5	UTSW	8	70889751	splice site	probably null
R2111:Slc5a5	UTSW	8	70889751	splice site	probably null
R2112:Slc5a5	UTSW	8	70889751	splice site	probably null
R2201:Slc5a5	UTSW	8	70892458	missense	probably damaging	0.98
R3978:Slc5a5	UTSW	8	70889395	missense	probably benign	0.00
R4244:Slc5a5	UTSW	8	70890286	missense	probably benign
R5161:Slc5a5	UTSW	8	70888848	missense	probably damaging	1.00
R5397:Slc5a5	UTSW	8	70891179	missense	probably damaging	1.00
R5718:Slc5a5	UTSW	8	70887755	missense	probably benign	0.00
R5740:Slc5a5	UTSW	8	70888917	splice site	probably null
R5869:Slc5a5	UTSW	8	70892330	missense	probably damaging	1.00
R6268:Slc5a5	UTSW	8	70888620	missense	probably damaging	1.00
R6290:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R6292:Slc5a5	UTSW	8	70891178	missense	probably damaging	1.00
R7098:Slc5a5	UTSW	8	70888538	missense	probably damaging	0.99
R7354:Slc5a5	UTSW	8	70889603	missense	probably damaging	1.00
R8777:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8777-TAIL:Slc5a5	UTSW	8	70891290	missense	possibly damaging	0.87
R8903:Slc5a5	UTSW	8	70892583	missense	probably damaging	1.00
R9474:Slc5a5	UTSW	8	70884952	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGAAAGGTCCTCTGGCTGCTCTC -3'
(R):5'- TATGGTGTGAACCAAGCCCAGGTG -3'

Sequencing Primer
(F):5'- GCTCTCTGCATCAAAAGCCTG -3'
(R):5'- CCCAGGTGCAGCGTTATG -3'

Posted On

2014-03-14