Incidental Mutation 'R1400:Krt13'
ID160338
Institutional Source Beutler Lab
Gene Symbol Krt13
Ensembl Gene ENSMUSG00000044041
Gene Namekeratin 13
SynonymsK13, Krt-1.13, Krt1-13
MMRRC Submission 039462-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1400 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100117327-100121566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100121284 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 71 (G71V)
Ref Sequence ENSEMBL: ENSMUSP00000007275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007275]
Predicted Effect probably damaging
Transcript: ENSMUST00000007275
AA Change: G71V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007275
Gene: ENSMUSG00000044041
AA Change: G71V

DomainStartEndE-ValueType
internal_repeat_1 5 21 1.02e-5 PROSPERO
internal_repeat_1 16 32 1.02e-5 PROSPERO
low complexity region 39 94 N/A INTRINSIC
Filament 95 407 7.21e-169 SMART
low complexity region 409 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134282
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik G T 9: 92,351,127 C25F probably benign Het
9130008F23Rik T C 17: 40,880,304 E78G probably damaging Het
Acsf2 T C 11: 94,570,316 I345V probably benign Het
Akap11 T A 14: 78,513,962 K328N probably damaging Het
Aoc1 T A 6: 48,906,283 Y364* probably null Het
Aoc1 A T 6: 48,906,711 Q507L probably benign Het
Atp6v1c2 T C 12: 17,289,130 T207A probably benign Het
Atr C A 9: 95,862,848 Q73K probably benign Het
Cage1 A G 13: 38,032,424 S17P possibly damaging Het
Cfap44 A T 16: 44,421,212 I649F probably benign Het
Cops4 A G 5: 100,533,546 K200R probably damaging Het
Crygd A G 1: 65,063,208 S32P probably damaging Het
Cyp3a11 A G 5: 145,862,489 I296T probably damaging Het
Fads3 A G 19: 10,056,300 probably null Het
Fbn2 T C 18: 58,080,193 E974G possibly damaging Het
Gcgr A G 11: 120,534,986 H45R probably benign Het
Gcn1l1 T C 5: 115,614,161 I2112T probably damaging Het
Gm43302 A T 5: 105,274,756 I470N probably damaging Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Las1l T C X: 95,946,900 T390A possibly damaging Het
Lifr T A 15: 7,190,865 V992E probably benign Het
Mbd5 T C 2: 49,274,776 probably null Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Ndst3 A G 3: 123,556,828 F636S probably damaging Het
Necab1 T C 4: 14,975,185 D232G possibly damaging Het
Nlrp4e A T 7: 23,321,660 E524V possibly damaging Het
Nxf3 T A X: 136,076,045 T349S probably benign Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr1013 T C 2: 85,770,133 C111R possibly damaging Het
Olfr1259 T A 2: 89,943,542 H191L possibly damaging Het
Olfr722 A T 14: 49,895,691 I37K possibly damaging Het
Olfr847 A G 9: 19,375,062 V273A probably damaging Het
Ppm1e T A 11: 87,231,766 N455I probably damaging Het
Prkag2 G A 5: 24,873,918 T158I probably damaging Het
Ptpn18 T C 1: 34,463,506 probably null Het
Rai14 T G 15: 10,571,548 K936N probably damaging Het
Rasgrf2 A G 13: 91,887,689 L1077P probably damaging Het
Rgn C A X: 20,550,457 Q27K probably benign Het
Ryr2 C T 13: 11,595,076 S723N probably benign Het
Scamp1 A G 13: 94,224,947 F142L possibly damaging Het
Selenon A G 4: 134,551,518 V67A probably benign Het
Slc5a5 T C 8: 70,889,435 I292V possibly damaging Het
Smarca2 C A 19: 26,676,740 T775K probably damaging Het
Stab1 C T 14: 31,139,830 V2437I possibly damaging Het
Tas2r143 C T 6: 42,400,383 A49V probably benign Het
Tlr7 T A X: 167,307,849 N214Y probably damaging Het
Unc13a C A 8: 71,651,221 D856Y probably damaging Het
Upp2 T C 2: 58,790,106 Y263H probably damaging Het
Vill T C 9: 119,063,347 S349P probably benign Het
Zfp644 T C 5: 106,637,470 probably null Het
Zfp664 T C 5: 124,886,153 C204R unknown Het
Zfp729b A G 13: 67,592,794 Y451H possibly damaging Het
Other mutations in Krt13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Krt13 APN 11 100119713 missense probably damaging 1.00
IGL02532:Krt13 APN 11 100119369 missense probably damaging 1.00
IGL02934:Krt13 APN 11 100119084 missense probably damaging 0.99
PIT4651001:Krt13 UTSW 11 100120036 missense probably damaging 0.98
R0092:Krt13 UTSW 11 100121432 nonsense probably null
R0722:Krt13 UTSW 11 100119153 missense probably damaging 1.00
R1228:Krt13 UTSW 11 100121477 missense probably benign 0.18
R1751:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R1767:Krt13 UTSW 11 100121100 missense possibly damaging 0.84
R2420:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2421:Krt13 UTSW 11 100120051 missense probably benign 0.43
R2869:Krt13 UTSW 11 100117649 missense unknown
R2869:Krt13 UTSW 11 100117649 missense unknown
R4421:Krt13 UTSW 11 100118935 missense possibly damaging 0.94
R4451:Krt13 UTSW 11 100118001 missense unknown
R4520:Krt13 UTSW 11 100119348 missense probably damaging 0.99
R4632:Krt13 UTSW 11 100121224 missense possibly damaging 0.96
R4656:Krt13 UTSW 11 100119363 missense probably damaging 1.00
R4872:Krt13 UTSW 11 100121506 start gained probably benign
R5709:Krt13 UTSW 11 100117643 missense unknown
R6014:Krt13 UTSW 11 100117611 missense unknown
R6323:Krt13 UTSW 11 100121150 missense probably damaging 1.00
R6391:Krt13 UTSW 11 100119376 missense probably damaging 0.96
R7535:Krt13 UTSW 11 100117998 missense unknown
R7562:Krt13 UTSW 11 100119336 missense probably damaging 1.00
R7867:Krt13 UTSW 11 100121182 missense probably damaging 1.00
R7950:Krt13 UTSW 11 100121182 missense probably damaging 1.00
X0013:Krt13 UTSW 11 100119348 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCAGTCACGAATCTTCACCTC -3'
(R):5'- TGGTCAAGTTCAGCTCCTGTCTGC -3'

Sequencing Primer
(F):5'- GAATCTTCACCTCCAGGTCGG -3'
(R):5'- CAGAGTTCCTCCATGAGCTATG -3'
Posted On2014-03-14