Mutagenetix > Incidental Mutation

Incidental Mutation 'R1406:Sp110'

160367

Institutional Source

Beutler Lab

Gene Symbol

Sp110

Ensembl Gene

ENSMUSG00000070034

Gene Name

Sp110 nuclear body protein

Synonyms

5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.534) question?

Stock #

R1406 (G1)

Quality Score

108

Status

Not validated

Chromosome

Chromosomal Location

85576899-85598817 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 85579079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 421 (E421A)

Ref Sequence

ENSEMBL: ENSMUSP00000091226 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]

AlphaFold

Q8BVK9

PDB Structure

Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000093508
AA Change: E421A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: E421A

Domain	Start	End	E-Value	Type
Pfam:Sp100	8	106	2.3e-41	PFAM
low complexity region	242	254	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
SAND	360	433	3.55e-28	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128339

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131950

Predicted Effect

probably benign
Transcript: ENSMUST00000178024

SMART Domains

Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

Domain	Start	End	E-Value	Type
low complexity region	1	10	N/A	INTRINSIC
low complexity region	82	122	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186740

Coding Region Coverage

1x: 99.5%
3x: 98.2%
10x: 92.2%
20x: 76.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,512,749	T733A	probably benign	Het
Antxrl	A	G	14: 34,073,042	N476D	possibly damaging	Het
Armc8	G	T	9: 99,523,248	P268Q	probably benign	Het
Asb8	C	A	15: 98,136,423	G84C	probably damaging	Het
BC027072	T	C	17: 71,749,161	N1174D	probably benign	Het
BC035044	A	T	6: 128,885,084		probably null	Het
Caprin1	A	G	2: 103,775,987	F303L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Ctdspl2	G	A	2: 122,006,868	R371Q	probably damaging	Het
Dctn4	T	A	18: 60,556,330	D431E	probably benign	Het
Dhx40	T	C	11: 86,797,745	E284G	probably benign	Het
Dhx9	A	G	1: 153,464,938	V652A	probably damaging	Het
Fnip2	G	T	3: 79,508,091	N213K	possibly damaging	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Itch	A	G	2: 155,206,354	E546G	possibly damaging	Het
Map3k20	A	T	2: 72,389,494	I257F	probably damaging	Het
Mdc1	C	T	17: 35,853,532	T1324I	probably benign	Het
Mertk	T	C	2: 128,771,486	I474T	probably benign	Het
Nav3	A	G	10: 109,883,634	V156A	possibly damaging	Het
Nbea	A	G	3: 56,037,281	V554A	probably benign	Het
Olfr1308	A	G	2: 111,960,581	V164A	probably benign	Het
Olfr157	C	T	4: 43,835,582	V303M	possibly damaging	Het
Olfr419	T	A	1: 174,250,861	E22V	possibly damaging	Het
Pask	A	G	1: 93,321,651	Y676H	probably benign	Het
Rab32	A	G	10: 10,550,893	V103A	probably damaging	Het
Rp1	T	C	1: 4,351,921	E262G	possibly damaging	Het
Rtn4	A	G	11: 29,708,236	T797A	probably benign	Het
Sall1	A	T	8: 89,032,444	I344K	probably benign	Het
Scnn1b	T	C	7: 121,902,544		probably null	Het
Slc7a2	G	T	8: 40,905,585	G322W	probably damaging	Het
Snx29	A	G	16: 11,399,793	M153V	probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Ush1c	A	C	7: 46,225,541		probably null	Het
Vmn2r8	C	T	5: 108,802,368	M204I	probably benign	Het
Zfp839	C	T	12: 110,866,310	T554M	probably damaging	Het

Other mutations in Sp110

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Sp110	APN	1	85577329	missense	probably benign
IGL00510:Sp110	APN	1	85577329	missense	probably benign
IGL00516:Sp110	APN	1	85577329	missense	probably benign
IGL00990:Sp110	APN	1	85586281	missense	possibly damaging	0.51
IGL03382:Sp110	APN	1	85577329	missense	probably benign
FR4342:Sp110	UTSW	1	85587488	small insertion	probably benign
FR4976:Sp110	UTSW	1	85587489	small insertion	probably benign
IGL03147:Sp110	UTSW	1	85591567	frame shift	probably null
PIT4131001:Sp110	UTSW	1	85586250	missense	probably benign	0.05
PIT4131001:Sp110	UTSW	1	85586254	missense	probably benign	0.01
PIT4142001:Sp110	UTSW	1	85586250	missense	probably benign	0.05
PIT4142001:Sp110	UTSW	1	85586254	missense	probably benign	0.01
R0472:Sp110	UTSW	1	85589120	missense	possibly damaging	0.79
R0483:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R0551:Sp110	UTSW	1	85589100	splice site	probably benign
R0638:Sp110	UTSW	1	85577329	missense	probably benign
R0806:Sp110	UTSW	1	85586254	missense	probably benign	0.01
R0806:Sp110	UTSW	1	85586281	missense	possibly damaging	0.51
R1074:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R1079:Sp110	UTSW	1	85589104	splice site	probably benign
R1228:Sp110	UTSW	1	85591760	missense	probably benign	0.03
R1403:Sp110	UTSW	1	85579079	missense	probably benign	0.00
R1418:Sp110	UTSW	1	85594385	missense	probably benign	0.08
R1718:Sp110	UTSW	1	85594385	missense	probably benign	0.08
R1744:Sp110	UTSW	1	85594372	missense	probably benign	0.26
R1747:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R1806:Sp110	UTSW	1	85596110	critical splice acceptor site	probably null
R1957:Sp110	UTSW	1	85577329	missense	probably benign
R2404:Sp110	UTSW	1	85577329	missense	probably benign
R2964:Sp110	UTSW	1	85577329	missense	probably benign
R3176:Sp110	UTSW	1	85577329	missense	probably benign
R4190:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R4398:Sp110	UTSW	1	85577329	missense	probably benign
R4505:Sp110	UTSW	1	85589173	missense	probably damaging	1.00
R4565:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R4625:Sp110	UTSW	1	85577329	missense	probably benign
R4922:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R4986:Sp110	UTSW	1	85591760	missense	probably benign	0.03
R5014:Sp110	UTSW	1	85577329	missense	probably benign
R5080:Sp110	UTSW	1	85596055	nonsense	probably null
R5087:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5254:Sp110	UTSW	1	85577202	utr 3 prime	probably benign
R5335:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5353:Sp110	UTSW	1	85589120	missense	possibly damaging	0.79
R5383:Sp110	UTSW	1	85591569	frame shift	probably null
R5387:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5389:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5398:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5443:Sp110	UTSW	1	85589120	missense	possibly damaging	0.79
R5447:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5729:Sp110	UTSW	1	85589118	missense	probably damaging	0.99
R5752:Sp110	UTSW	1	85577202	utr 3 prime	probably benign
R5754:Sp110	UTSW	1	85577202	utr 3 prime	probably benign
R5799:Sp110	UTSW	1	85577329	missense	probably benign
R6027:Sp110	UTSW	1	85577318	missense	possibly damaging	0.83
R6171:Sp110	UTSW	1	85577329	missense	probably benign
R6367:Sp110	UTSW	1	85594292	missense	probably benign	0.00
R6771:Sp110	UTSW	1	85592279	splice site	probably null
R7097:Sp110	UTSW	1	85579685	missense	possibly damaging	0.80
R7519:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7520:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7594:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7596:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7598:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7600:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7601:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7602:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7640:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7641:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7674:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7691:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R7695:Sp110	UTSW	1	85579092	missense	probably benign	0.01
R8072:Sp110	UTSW	1	85587486	small insertion	probably benign
R8794:Sp110	UTSW	1	85583510	critical splice donor site	probably null
R9284:Sp110	UTSW	1	85579642	critical splice donor site	probably null
R9350:Sp110	UTSW	1	85579092	missense	probably benign	0.01
X0035:Sp110	UTSW	1	85586254	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGATCACAGCAACCTTGGCCTC -3'
(R):5'- CTCTGGGACAGTGAAAAGCCATAGC -3'

Sequencing Primer
(F):5'- AGCATATTCTGCTTGCACTAGG -3'
(R):5'- ACTCAAAGGTCTGTGGTAAAGTC -3'

Posted On

2014-03-14