Incidental Mutation 'R1406:Pask'
ID 160368
Institutional Source Beutler Lab
Gene Symbol Pask
Ensembl Gene ENSMUSG00000026274
Gene Name PAS domain containing serine/threonine kinase
Synonyms Paskin
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1406 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 93237159-93271244 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93249373 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 676 (Y676H)
Ref Sequence ENSEMBL: ENSMUSP00000027493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027493]
AlphaFold Q8CEE6
Predicted Effect probably benign
Transcript: ENSMUST00000027493
AA Change: Y676H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: Y676H

DomainStartEndE-ValueType
PAS 119 186 3.87e-8 SMART
PAS 333 400 3.08e-2 SMART
low complexity region 907 918 N/A INTRINSIC
low complexity region 1043 1054 N/A INTRINSIC
S_TKc 1059 1311 8.16e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128655
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188069
Meta Mutation Damage Score 0.0640 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.2%
  • 20x: 76.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,750,189 (GRCm39) T733A probably benign Het
Antxrl A G 14: 33,794,999 (GRCm39) N476D possibly damaging Het
Armc8 G T 9: 99,405,301 (GRCm39) P268Q probably benign Het
Asb8 C A 15: 98,034,304 (GRCm39) G84C probably damaging Het
BC035044 A T 6: 128,862,047 (GRCm39) probably null Het
Caprin1 A G 2: 103,606,332 (GRCm39) F303L probably benign Het
Cdh20 G A 1: 109,988,862 (GRCm39) V255I probably benign Het
Ctdspl2 G A 2: 121,837,349 (GRCm39) R371Q probably damaging Het
Dctn4 T A 18: 60,689,402 (GRCm39) D431E probably benign Het
Dhx40 T C 11: 86,688,571 (GRCm39) E284G probably benign Het
Dhx9 A G 1: 153,340,684 (GRCm39) V652A probably damaging Het
Fnip2 G T 3: 79,415,398 (GRCm39) N213K possibly damaging Het
Gm17535 A G 9: 3,035,804 (GRCm39) Y224C probably null Het
Itch A G 2: 155,048,274 (GRCm39) E546G possibly damaging Het
Map3k20 A T 2: 72,219,838 (GRCm39) I257F probably damaging Het
Mdc1 C T 17: 36,164,424 (GRCm39) T1324I probably benign Het
Mertk T C 2: 128,613,406 (GRCm39) I474T probably benign Het
Nav3 A G 10: 109,719,495 (GRCm39) V156A possibly damaging Het
Nbea A G 3: 55,944,702 (GRCm39) V554A probably benign Het
Or10z1 T A 1: 174,078,427 (GRCm39) E22V possibly damaging Het
Or13c7c C T 4: 43,835,582 (GRCm39) V303M possibly damaging Het
Or4f57 A G 2: 111,790,926 (GRCm39) V164A probably benign Het
Pcare T C 17: 72,056,156 (GRCm39) N1174D probably benign Het
Rab32 A G 10: 10,426,637 (GRCm39) V103A probably damaging Het
Rp1 T C 1: 4,422,144 (GRCm39) E262G possibly damaging Het
Rtn4 A G 11: 29,658,236 (GRCm39) T797A probably benign Het
Sall1 A T 8: 89,759,072 (GRCm39) I344K probably benign Het
Scnn1b T C 7: 121,501,767 (GRCm39) probably null Het
Slc7a2 G T 8: 41,358,622 (GRCm39) G322W probably damaging Het
Snx29 A G 16: 11,217,657 (GRCm39) M153V probably benign Het
Sp110 T G 1: 85,506,800 (GRCm39) E421A probably benign Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Ush1c A C 7: 45,874,965 (GRCm39) probably null Het
Vmn2r8 C T 5: 108,950,234 (GRCm39) M204I probably benign Het
Zfp839 C T 12: 110,832,744 (GRCm39) T554M probably damaging Het
Other mutations in Pask
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Pask APN 1 93,238,574 (GRCm39) missense probably benign 0.02
IGL01620:Pask APN 1 93,237,844 (GRCm39) missense possibly damaging 0.87
IGL01959:Pask APN 1 93,262,329 (GRCm39) missense probably benign 0.03
IGL02170:Pask APN 1 93,238,606 (GRCm39) missense possibly damaging 0.69
IGL02499:Pask APN 1 93,248,817 (GRCm39) nonsense probably null
IGL02670:Pask APN 1 93,238,540 (GRCm39) missense probably damaging 1.00
IGL03066:Pask APN 1 93,258,588 (GRCm39) missense probably benign 0.02
IGL03210:Pask APN 1 93,247,714 (GRCm39) missense possibly damaging 0.92
R0472:Pask UTSW 1 93,248,639 (GRCm39) missense probably benign 0.00
R0524:Pask UTSW 1 93,238,556 (GRCm39) missense probably damaging 1.00
R0854:Pask UTSW 1 93,255,156 (GRCm39) missense possibly damaging 0.79
R0854:Pask UTSW 1 93,255,122 (GRCm39) missense probably damaging 0.99
R0854:Pask UTSW 1 93,255,134 (GRCm39) missense probably damaging 1.00
R0863:Pask UTSW 1 93,242,061 (GRCm39) missense probably damaging 1.00
R1052:Pask UTSW 1 93,258,549 (GRCm39) missense probably benign 0.00
R1406:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R1831:Pask UTSW 1 93,248,491 (GRCm39) splice site probably null
R1958:Pask UTSW 1 93,249,180 (GRCm39) missense probably benign 0.00
R2143:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2144:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2145:Pask UTSW 1 93,249,019 (GRCm39) missense probably benign 0.00
R2509:Pask UTSW 1 93,258,485 (GRCm39) missense possibly damaging 0.62
R2858:Pask UTSW 1 93,249,373 (GRCm39) missense probably benign 0.00
R2899:Pask UTSW 1 93,262,269 (GRCm39) missense probably damaging 1.00
R3545:Pask UTSW 1 93,244,837 (GRCm39) missense probably damaging 1.00
R3778:Pask UTSW 1 93,255,189 (GRCm39) missense probably damaging 1.00
R4111:Pask UTSW 1 93,238,540 (GRCm39) missense probably damaging 1.00
R4514:Pask UTSW 1 93,249,855 (GRCm39) missense probably benign 0.03
R4527:Pask UTSW 1 93,248,224 (GRCm39) missense probably benign
R4580:Pask UTSW 1 93,249,830 (GRCm39) missense probably benign 0.36
R4718:Pask UTSW 1 93,249,918 (GRCm39) missense possibly damaging 0.67
R4775:Pask UTSW 1 93,265,246 (GRCm39) missense probably damaging 0.97
R5036:Pask UTSW 1 93,249,801 (GRCm39) nonsense probably null
R5070:Pask UTSW 1 93,258,596 (GRCm39) missense probably damaging 1.00
R5084:Pask UTSW 1 93,249,819 (GRCm39) missense probably benign
R5151:Pask UTSW 1 93,262,350 (GRCm39) missense probably damaging 1.00
R5196:Pask UTSW 1 93,237,805 (GRCm39) unclassified probably benign
R5643:Pask UTSW 1 93,265,065 (GRCm39) critical splice donor site probably null
R5739:Pask UTSW 1 93,249,778 (GRCm39) missense probably benign
R6126:Pask UTSW 1 93,242,081 (GRCm39) missense probably damaging 1.00
R7161:Pask UTSW 1 93,238,627 (GRCm39) missense probably benign
R7284:Pask UTSW 1 93,248,391 (GRCm39) missense probably benign 0.01
R7289:Pask UTSW 1 93,259,309 (GRCm39) missense probably damaging 1.00
R8277:Pask UTSW 1 93,253,085 (GRCm39) critical splice donor site probably null
R8303:Pask UTSW 1 93,248,286 (GRCm39) missense probably benign 0.10
R8309:Pask UTSW 1 93,240,573 (GRCm39) nonsense probably null
R8321:Pask UTSW 1 93,248,377 (GRCm39) missense possibly damaging 0.85
R8476:Pask UTSW 1 93,249,361 (GRCm39) missense probably benign 0.00
R8814:Pask UTSW 1 93,248,307 (GRCm39) missense probably benign 0.00
R9061:Pask UTSW 1 93,253,191 (GRCm39) nonsense probably null
R9198:Pask UTSW 1 93,265,205 (GRCm39) missense possibly damaging 0.72
R9406:Pask UTSW 1 93,251,987 (GRCm39) missense probably benign 0.02
R9578:Pask UTSW 1 93,263,390 (GRCm39) missense probably benign 0.00
Z1088:Pask UTSW 1 93,244,523 (GRCm39) missense probably damaging 1.00
Z1177:Pask UTSW 1 93,263,454 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGATGCCCAGATTTCCCTCACAG -3'
(R):5'- TCCTTCAGCAGCAGAGAGCTACAG -3'

Sequencing Primer
(F):5'- CTCACAGCTTGACTTGGATAACTG -3'
(R):5'- GGATGCAAAACTGTTTGCTTC -3'
Posted On 2014-03-14