Mutagenetix > Incidental Mutation

Incidental Mutation 'R1406:Pask'

160368

Institutional Source

Beutler Lab

Gene Symbol

Pask

Ensembl Gene

ENSMUSG00000026274

Gene Name

PAS domain containing serine/threonine kinase

Synonyms

Paskin

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R1406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

93308770-93343482 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93321651 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 676 (Y676H)

Ref Sequence

ENSEMBL: ENSMUSP00000027493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027493]

AlphaFold

Q8CEE6

Predicted Effect

probably benign
Transcript: ENSMUST00000027493
AA Change: Y676H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000027493
Gene: ENSMUSG00000026274
AA Change: Y676H

Domain	Start	End	E-Value	Type
PAS	119	186	3.87e-8	SMART
PAS	333	400	3.08e-2	SMART
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1043	1054	N/A	INTRINSIC
S_TKc	1059	1311	8.16e-79	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128655

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139028

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188069

Meta Mutation Damage Score

0.0640

Coding Region Coverage

1x: 99.5%
3x: 98.2%
10x: 92.2%
20x: 76.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice display resistance to diet-induced obesity, impaired glucose stimulated insulin secretion, abnormal energy balance, and abnormalities in hypoxia induced changes in ventialtion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,512,749	T733A	probably benign	Het
Antxrl	A	G	14: 34,073,042	N476D	possibly damaging	Het
Armc8	G	T	9: 99,523,248	P268Q	probably benign	Het
Asb8	C	A	15: 98,136,423	G84C	probably damaging	Het
BC027072	T	C	17: 71,749,161	N1174D	probably benign	Het
BC035044	A	T	6: 128,885,084		probably null	Het
Caprin1	A	G	2: 103,775,987	F303L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Ctdspl2	G	A	2: 122,006,868	R371Q	probably damaging	Het
Dctn4	T	A	18: 60,556,330	D431E	probably benign	Het
Dhx40	T	C	11: 86,797,745	E284G	probably benign	Het
Dhx9	A	G	1: 153,464,938	V652A	probably damaging	Het
Fnip2	G	T	3: 79,508,091	N213K	possibly damaging	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Itch	A	G	2: 155,206,354	E546G	possibly damaging	Het
Map3k20	A	T	2: 72,389,494	I257F	probably damaging	Het
Mdc1	C	T	17: 35,853,532	T1324I	probably benign	Het
Mertk	T	C	2: 128,771,486	I474T	probably benign	Het
Nav3	A	G	10: 109,883,634	V156A	possibly damaging	Het
Nbea	A	G	3: 56,037,281	V554A	probably benign	Het
Olfr1308	A	G	2: 111,960,581	V164A	probably benign	Het
Olfr157	C	T	4: 43,835,582	V303M	possibly damaging	Het
Olfr419	T	A	1: 174,250,861	E22V	possibly damaging	Het
Rab32	A	G	10: 10,550,893	V103A	probably damaging	Het
Rp1	T	C	1: 4,351,921	E262G	possibly damaging	Het
Rtn4	A	G	11: 29,708,236	T797A	probably benign	Het
Sall1	A	T	8: 89,032,444	I344K	probably benign	Het
Scnn1b	T	C	7: 121,902,544		probably null	Het
Slc7a2	G	T	8: 40,905,585	G322W	probably damaging	Het
Snx29	A	G	16: 11,399,793	M153V	probably benign	Het
Sp110	T	G	1: 85,579,079	E421A	probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Ush1c	A	C	7: 46,225,541		probably null	Het
Vmn2r8	C	T	5: 108,802,368	M204I	probably benign	Het
Zfp839	C	T	12: 110,866,310	T554M	probably damaging	Het

Other mutations in Pask

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01366:Pask	APN	1	93310852	missense	probably benign	0.02
IGL01620:Pask	APN	1	93310122	missense	possibly damaging	0.87
IGL01959:Pask	APN	1	93334607	missense	probably benign	0.03
IGL02170:Pask	APN	1	93310884	missense	possibly damaging	0.69
IGL02499:Pask	APN	1	93321095	nonsense	probably null
IGL02670:Pask	APN	1	93310818	missense	probably damaging	1.00
IGL03066:Pask	APN	1	93330866	missense	probably benign	0.02
IGL03210:Pask	APN	1	93319992	missense	possibly damaging	0.92
R0472:Pask	UTSW	1	93320917	missense	probably benign	0.00
R0524:Pask	UTSW	1	93310834	missense	probably damaging	1.00
R0854:Pask	UTSW	1	93327400	missense	probably damaging	0.99
R0854:Pask	UTSW	1	93327412	missense	probably damaging	1.00
R0854:Pask	UTSW	1	93327434	missense	possibly damaging	0.79
R0863:Pask	UTSW	1	93314339	missense	probably damaging	1.00
R1052:Pask	UTSW	1	93330827	missense	probably benign	0.00
R1406:Pask	UTSW	1	93321651	missense	probably benign	0.00
R1831:Pask	UTSW	1	93320769	splice site	probably null
R1958:Pask	UTSW	1	93321458	missense	probably benign	0.00
R2143:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2144:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2145:Pask	UTSW	1	93321297	missense	probably benign	0.00
R2509:Pask	UTSW	1	93330763	missense	possibly damaging	0.62
R2858:Pask	UTSW	1	93321651	missense	probably benign	0.00
R2899:Pask	UTSW	1	93334547	missense	probably damaging	1.00
R3545:Pask	UTSW	1	93317115	missense	probably damaging	1.00
R3778:Pask	UTSW	1	93327467	missense	probably damaging	1.00
R4111:Pask	UTSW	1	93310818	missense	probably damaging	1.00
R4514:Pask	UTSW	1	93322133	missense	probably benign	0.03
R4527:Pask	UTSW	1	93320502	missense	probably benign
R4580:Pask	UTSW	1	93322108	missense	probably benign	0.36
R4718:Pask	UTSW	1	93322196	missense	possibly damaging	0.67
R4775:Pask	UTSW	1	93337524	missense	probably damaging	0.97
R5036:Pask	UTSW	1	93322079	nonsense	probably null
R5070:Pask	UTSW	1	93330874	missense	probably damaging	1.00
R5084:Pask	UTSW	1	93322097	missense	probably benign
R5151:Pask	UTSW	1	93334628	missense	probably damaging	1.00
R5196:Pask	UTSW	1	93310083	unclassified	probably benign
R5643:Pask	UTSW	1	93337343	critical splice donor site	probably null
R5739:Pask	UTSW	1	93322056	missense	probably benign
R6126:Pask	UTSW	1	93314359	missense	probably damaging	1.00
R7161:Pask	UTSW	1	93310905	missense	probably benign
R7284:Pask	UTSW	1	93320669	missense	probably benign	0.01
R7289:Pask	UTSW	1	93331587	missense	probably damaging	1.00
R8277:Pask	UTSW	1	93325363	critical splice donor site	probably null
R8303:Pask	UTSW	1	93320564	missense	probably benign	0.10
R8309:Pask	UTSW	1	93312851	nonsense	probably null
R8321:Pask	UTSW	1	93320655	missense	possibly damaging	0.85
R8476:Pask	UTSW	1	93321639	missense	probably benign	0.00
R8814:Pask	UTSW	1	93320585	missense	probably benign	0.00
R9061:Pask	UTSW	1	93325469	nonsense	probably null
R9198:Pask	UTSW	1	93337483	missense	possibly damaging	0.72
R9406:Pask	UTSW	1	93324265	missense	probably benign	0.02
R9578:Pask	UTSW	1	93335668	missense	probably benign	0.00
Z1088:Pask	UTSW	1	93316801	missense	probably damaging	1.00
Z1177:Pask	UTSW	1	93335732	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGATGCCCAGATTTCCCTCACAG -3'
(R):5'- TCCTTCAGCAGCAGAGAGCTACAG -3'

Sequencing Primer
(F):5'- CTCACAGCTTGACTTGGATAACTG -3'
(R):5'- GGATGCAAAACTGTTTGCTTC -3'

Posted On

2014-03-14