Incidental Mutation 'R1406:Ush1c'
ID160385
Institutional Source Beutler Lab
Gene Symbol Ush1c
Ensembl Gene ENSMUSG00000030838
Gene NameUSH1 protein network component harmonin
Synonymsharmonin, 2010016F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location46195350-46238503 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 46225541 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009667] [ENSMUST00000078680] [ENSMUST00000143155] [ENSMUST00000154292] [ENSMUST00000154292] [ENSMUST00000176371] [ENSMUST00000176371] [ENSMUST00000177212] [ENSMUST00000177212] [ENSMUST00000222454]
Predicted Effect probably null
Transcript: ENSMUST00000009667
SMART Domains Protein: ENSMUSP00000009667
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
low complexity region 899 910 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078680
SMART Domains Protein: ENSMUSP00000077747
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
PDZ 458 537 1.13e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143155
SMART Domains Protein: ENSMUSP00000119676
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154292
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154292
SMART Domains Protein: ENSMUSP00000114494
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 292 5.62e-18 SMART
coiled coil region 301 376 N/A INTRINSIC
coiled coil region 419 478 N/A INTRINSIC
low complexity region 515 529 N/A INTRINSIC
low complexity region 562 596 N/A INTRINSIC
low complexity region 600 612 N/A INTRINSIC
PDZ 762 841 1.13e-13 SMART
low complexity region 846 860 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000176371
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000176371
SMART Domains Protein: ENSMUSP00000134783
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 65 137 3.06e-19 SMART
low complexity region 159 172 N/A INTRINSIC
PDZ 189 261 5.62e-18 SMART
coiled coil region 270 345 N/A INTRINSIC
PDZ 427 506 1.13e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177212
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000177212
SMART Domains Protein: ENSMUSP00000135734
Gene: ENSMUSG00000030838

DomainStartEndE-ValueType
PDZ 96 168 3.06e-19 SMART
low complexity region 190 203 N/A INTRINSIC
PDZ 220 291 6.13e-10 SMART
low complexity region 313 325 N/A INTRINSIC
low complexity region 339 357 N/A INTRINSIC
PDZ 439 518 1.13e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000222454
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.2%
  • 20x: 76.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a scaffold protein that functions in the assembly of Usher protein complexes. The protein contains PDZ domains, a coiled-coil region with a bipartite nuclear localization signal and a PEST degradation sequence. Defects in this gene are the cause of Usher syndrome type 1C and non-syndromic sensorineural deafness autosomal recessive type 18. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mutations at this locus affect hearing and result in movement anomalies generally associated with vestibular mutants, such as head tossing and circling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Sp110 T G 1: 85,579,079 E421A probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Ush1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ush1c APN 7 46196770 missense probably benign 0.00
IGL01074:Ush1c APN 7 46225250 splice site probably benign
IGL01099:Ush1c APN 7 46205262 missense probably damaging 0.99
IGL01107:Ush1c APN 7 46209901 missense probably damaging 1.00
IGL01446:Ush1c APN 7 46208956 missense possibly damaging 0.86
IGL02267:Ush1c APN 7 46209298 missense possibly damaging 0.92
IGL02307:Ush1c APN 7 46197188 splice site probably benign
IGL02448:Ush1c APN 7 46209137 missense possibly damaging 0.51
IGL02485:Ush1c APN 7 46229250 missense probably damaging 0.99
IGL02896:Ush1c APN 7 46198415 missense probably benign 0.00
IGL03031:Ush1c APN 7 46224937 splice site probably benign
R0085:Ush1c UTSW 7 46225555 missense probably benign 0.09
R0328:Ush1c UTSW 7 46225448 splice site probably benign
R0574:Ush1c UTSW 7 46196804 missense possibly damaging 0.68
R0600:Ush1c UTSW 7 46224908 missense probably benign 0.00
R1187:Ush1c UTSW 7 46208914 missense probably benign 0.01
R1406:Ush1c UTSW 7 46225541 critical splice donor site probably null
R1716:Ush1c UTSW 7 46195728 missense probably benign 0.18
R1727:Ush1c UTSW 7 46209231 missense probably damaging 1.00
R1822:Ush1c UTSW 7 46209901 missense probably damaging 1.00
R1864:Ush1c UTSW 7 46219392 nonsense probably null
R2000:Ush1c UTSW 7 46221433 missense probably damaging 0.99
R2063:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2068:Ush1c UTSW 7 46229481 missense probably damaging 1.00
R2944:Ush1c UTSW 7 46200982 missense probably damaging 1.00
R4042:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4043:Ush1c UTSW 7 46221528 missense probably damaging 0.97
R4108:Ush1c UTSW 7 46198445 missense probably damaging 1.00
R4823:Ush1c UTSW 7 46195733 missense probably benign 0.00
R4862:Ush1c UTSW 7 46229240 missense probably damaging 1.00
R5534:Ush1c UTSW 7 46221423 missense probably damaging 1.00
R5922:Ush1c UTSW 7 46204128 critical splice donor site probably null
R6249:Ush1c UTSW 7 46214959 missense probably damaging 1.00
R6475:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R6485:Ush1c UTSW 7 46209110 missense probably benign
R6667:Ush1c UTSW 7 46225624 missense probably damaging 1.00
R7177:Ush1c UTSW 7 46229219 missense probably damaging 0.99
R7419:Ush1c UTSW 7 46229255 missense probably damaging 1.00
R7424:Ush1c UTSW 7 46225555 missense probably benign 0.09
R7811:Ush1c UTSW 7 46205286 nonsense probably null
R7862:Ush1c UTSW 7 46221424 missense probably damaging 0.99
R8182:Ush1c UTSW 7 46198351 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGAGGAGACTCACAGATAAGCCTGC -3'
(R):5'- AAAAGTGTTGCCTGCCGCTGTC -3'

Sequencing Primer
(F):5'- GCTTACCTCTTCACAGGGATCAG -3'
(R):5'- AAGCTTTTGCTTGATGACAGCC -3'
Posted On2014-03-14