Incidental Mutation 'R1406:BC027072'
ID160402
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71749161 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1174 (N1174D)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably benign
Transcript: ENSMUST00000057405
AA Change: N1174D

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: N1174D

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.2%
  • 10x: 92.2%
  • 20x: 76.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Sp110 T G 1: 85,579,079 E421A probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R1941:BC027072 UTSW 17 71752068 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
R7575:BC027072 UTSW 17 71750855 missense probably damaging 1.00
R7638:BC027072 UTSW 17 71750885 missense probably damaging 1.00
R7848:BC027072 UTSW 17 71749193 missense probably benign 0.04
R8317:BC027072 UTSW 17 71749202 missense probably benign 0.10
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Z1177:BC027072 UTSW 17 71750403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTTCCTTTGGAACACGGTTTG -3'
(R):5'- TCACTCTGAGGACAGTGAGGCTAC -3'

Sequencing Primer
(F):5'- TTGAAATCTATTAAACCAGACAGTCC -3'
(R):5'- GACAGTGAGGCTACCACAGC -3'
Posted On2014-03-14