Mutagenetix > Incidental Mutations

Incidental Mutation 'R1403:Arhgap29'

160433

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

039465-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1403 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121973929 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 7 (K7E)

Ref Sequence

ENSEMBL: ENSMUSP00000044624 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000196479] [ENSMUST00000196904] [ENSMUST00000196984] [ENSMUST00000197155]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037958
AA Change: K7E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: K7E

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196479

SMART Domains

Protein: ENSMUSP00000142817
Gene: ENSMUSG00000039831

Domain	Start	End	E-Value	Type
PDB:3QWE\|A	129	271	1e-28	PDB
Blast:FCH	133	220	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000196904

Predicted Effect

silent
Transcript: ENSMUST00000196984

Predicted Effect

probably damaging
Transcript: ENSMUST00000197155
AA Change: K7E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831
AA Change: K7E

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Meta Mutation Damage Score

0.0623

Coding Region Coverage

1x: 99.3%
3x: 97.5%
10x: 88.5%
20x: 65.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsf2	G	T	11: 94,562,874	N420K	probably benign	Het
Adam26a	A	T	8: 43,569,192	C420*	probably null	Het
Afap1l1	T	C	18: 61,741,838	Y424C	probably damaging	Het
Agl	A	G	3: 116,782,597	V553A	probably benign	Het
Akr7a5	T	A	4: 139,318,123	M325K	probably damaging	Het
Aldh7a1	C	A	18: 56,559,269	E87*	probably null	Het
Brca2	T	A	5: 150,542,649	D1959E	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Chil5	G	T	3: 106,018,093	Q171K	probably benign	Het
Cul9	C	G	17: 46,522,175	A1326P	probably damaging	Het
Dhrs7c	A	T	11: 67,811,650	I155F	probably damaging	Het
Dip2c	A	G	13: 9,553,264		probably null	Het
Fam124b	T	C	1: 80,213,339	Y109C	possibly damaging	Het
Gak	T	A	5: 108,591,145	K156M	probably damaging	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Got1l1	C	G	8: 27,200,717		probably null	Het
Grm1	T	C	10: 11,080,135	D135G	probably benign	Het
Hrh3	T	G	2: 180,102,754	D131A	probably damaging	Het
Hspg2	C	T	4: 137,540,100	L2042F	possibly damaging	Het
Itpr1	A	T	6: 108,389,553	Q979L	probably null	Het
Klb	G	C	5: 65,348,746	R112P	possibly damaging	Het
Lingo2	A	T	4: 35,709,420	C187S	possibly damaging	Het
Lrp1	T	A	10: 127,581,891		probably null	Het
Ltbp4	T	C	7: 27,329,039	N266S	unknown	Het
Mgam	G	A	6: 40,666,881	S581N	possibly damaging	Het
Mrgpra9	T	A	7: 47,235,638	I94L	probably benign	Het
Msantd4	A	T	9: 4,384,023	I115F	probably benign	Het
Nrxn1	A	C	17: 90,643,053	L566R	probably benign	Het
Olfr483	T	A	7: 108,103,615	I102N	probably benign	Het
Prl7d1	A	T	13: 27,709,197	F243I	possibly damaging	Het
Rbm27	T	C	18: 42,317,681	S509P	probably damaging	Het
Rnf44	C	T	13: 54,682,008	E306K	probably damaging	Het
Rp1	T	C	1: 4,346,297	R1531G	possibly damaging	Het
Sf3b4	A	G	3: 96,173,637		probably null	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sfi1	CCTCTC	CCTCTCTC	11: 3,177,419		probably benign	Het
Sp110	T	G	1: 85,579,079	E421A	probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Vcan	T	A	13: 89,688,484	E2980D	probably benign	Het
Vwa2	C	T	19: 56,881,138	P2S	unknown	Het
Wdr77	G	A	3: 105,967,257	V322I	possibly damaging	Het
Zfp12	C	A	5: 143,244,780	Y287*	probably null	Het
Zfp937	T	A	2: 150,238,948	Y299*	probably null	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2112:Arhgap29	UTSW	3	122011561	missense	probably benign	0.03
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAAGCTCAGGCTCTTTGCATTG -3'
(R):5'- TGCTCTTGTCATGGGACACACATTG -3'

Sequencing Primer
(F):5'- ATCATGGAGTTGTCAGACACTCG -3'
(R):5'- GTTGACAAACCTGAAAGAATAGCTTC -3'

Posted On

2014-03-14