Incidental Mutation 'R1403:Prl7d1'
ID 160459
Institutional Source Beutler Lab
Gene Symbol Prl7d1
Ensembl Gene ENSMUSG00000021348
Gene Name prolactin family 7, subfamily d, member 1
Synonyms Plfr, PRP, PLF-RP
MMRRC Submission 039465-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1403 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 27706337-27716736 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27709197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 243 (F243I)
Ref Sequence ENSEMBL: ENSMUSP00000021776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021776] [ENSMUST00000224026]
AlphaFold P04769
Predicted Effect possibly damaging
Transcript: ENSMUST00000021776
AA Change: F243I

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021776
Gene: ENSMUSG00000021348
AA Change: F243I

DomainStartEndE-ValueType
Pfam:Hormone_1 17 240 1.1e-78 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000224026
AA Change: F244I

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 97.5%
  • 10x: 88.5%
  • 20x: 65.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf2 G T 11: 94,562,874 N420K probably benign Het
Adam26a A T 8: 43,569,192 C420* probably null Het
Afap1l1 T C 18: 61,741,838 Y424C probably damaging Het
Agl A G 3: 116,782,597 V553A probably benign Het
Akr7a5 T A 4: 139,318,123 M325K probably damaging Het
Aldh7a1 C A 18: 56,559,269 E87* probably null Het
Arhgap29 A G 3: 121,973,929 K7E probably damaging Het
Brca2 T A 5: 150,542,649 D1959E probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Chil5 G T 3: 106,018,093 Q171K probably benign Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dhrs7c A T 11: 67,811,650 I155F probably damaging Het
Dip2c A G 13: 9,553,264 probably null Het
Fam124b T C 1: 80,213,339 Y109C possibly damaging Het
Gak T A 5: 108,591,145 K156M probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Got1l1 C G 8: 27,200,717 probably null Het
Grm1 T C 10: 11,080,135 D135G probably benign Het
Hrh3 T G 2: 180,102,754 D131A probably damaging Het
Hspg2 C T 4: 137,540,100 L2042F possibly damaging Het
Itpr1 A T 6: 108,389,553 Q979L probably null Het
Klb G C 5: 65,348,746 R112P possibly damaging Het
Lingo2 A T 4: 35,709,420 C187S possibly damaging Het
Lrp1 T A 10: 127,581,891 probably null Het
Ltbp4 T C 7: 27,329,039 N266S unknown Het
Mgam G A 6: 40,666,881 S581N possibly damaging Het
Mrgpra9 T A 7: 47,235,638 I94L probably benign Het
Msantd4 A T 9: 4,384,023 I115F probably benign Het
Nrxn1 A C 17: 90,643,053 L566R probably benign Het
Olfr483 T A 7: 108,103,615 I102N probably benign Het
Rbm27 T C 18: 42,317,681 S509P probably damaging Het
Rnf44 C T 13: 54,682,008 E306K probably damaging Het
Rp1 T C 1: 4,346,297 R1531G possibly damaging Het
Sf3b4 A G 3: 96,173,637 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sp110 T G 1: 85,579,079 E421A probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Vcan T A 13: 89,688,484 E2980D probably benign Het
Vwa2 C T 19: 56,881,138 P2S unknown Het
Wdr77 G A 3: 105,967,257 V322I possibly damaging Het
Zfp12 C A 5: 143,244,780 Y287* probably null Het
Zfp937 T A 2: 150,238,948 Y299* probably null Het
Other mutations in Prl7d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Prl7d1 APN 13 27710166 missense possibly damaging 0.91
IGL01735:Prl7d1 APN 13 27714389 missense possibly damaging 0.83
IGL02139:Prl7d1 APN 13 27712083 missense probably damaging 1.00
PIT4305001:Prl7d1 UTSW 13 27714337 missense possibly damaging 0.90
PIT4531001:Prl7d1 UTSW 13 27710178 missense probably damaging 1.00
R0555:Prl7d1 UTSW 13 27712055 missense probably benign 0.13
R0625:Prl7d1 UTSW 13 27710140 missense probably benign 0.10
R0631:Prl7d1 UTSW 13 27710182 missense probably benign 0.32
R0837:Prl7d1 UTSW 13 27714338 missense probably benign 0.06
R1403:Prl7d1 UTSW 13 27709197 missense possibly damaging 0.89
R1459:Prl7d1 UTSW 13 27709257 missense possibly damaging 0.81
R1643:Prl7d1 UTSW 13 27712131 missense possibly damaging 0.53
R1691:Prl7d1 UTSW 13 27709382 missense probably damaging 0.97
R2016:Prl7d1 UTSW 13 27710173 missense probably damaging 1.00
R3873:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R3874:Prl7d1 UTSW 13 27716668 start codon destroyed probably null 0.92
R5251:Prl7d1 UTSW 13 27709244 missense probably benign 0.33
R5275:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5295:Prl7d1 UTSW 13 27709247 missense probably damaging 0.99
R5398:Prl7d1 UTSW 13 27710074 missense probably damaging 1.00
R6798:Prl7d1 UTSW 13 27709397 critical splice acceptor site probably null
R6818:Prl7d1 UTSW 13 27714471 missense probably benign 0.07
R6825:Prl7d1 UTSW 13 27710142 missense probably benign 0.01
R7478:Prl7d1 UTSW 13 27710185 nonsense probably null
R7795:Prl7d1 UTSW 13 27709280 missense probably damaging 1.00
R7995:Prl7d1 UTSW 13 27710071 missense probably benign
R8193:Prl7d1 UTSW 13 27709247 missense
R9313:Prl7d1 UTSW 13 27709199 missense probably benign
R9424:Prl7d1 UTSW 13 27710202 missense probably benign 0.00
R9430:Prl7d1 UTSW 13 27714377 missense possibly damaging 0.80
R9733:Prl7d1 UTSW 13 27714356 missense probably benign 0.00
R9758:Prl7d1 UTSW 13 27709277 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTTGCCTGGAATGTGACTTAAGCC -3'
(R):5'- AGAAGCAGAAATCCATGCCTGTGAC -3'

Sequencing Primer
(F):5'- CTTAAGCCACAGAAGAATGCTG -3'
(R):5'- TCAGCCTTTAGAAGGCATAGGTC -3'
Posted On 2014-03-14