Incidental Mutation 'R1404:Itga6'
ID160475
Institutional Source Beutler Lab
Gene Symbol Itga6
Ensembl Gene ENSMUSG00000027111
Gene Nameintegrin alpha 6
SynonymsCd49f, 5033401O05Rik
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1404 (G1)
Quality Score183
Status Not validated
Chromosome2
Chromosomal Location71745616-71858416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71838716 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 617 (T617A)
Ref Sequence ENSEMBL: ENSMUSP00000107729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028522] [ENSMUST00000112101]
Predicted Effect probably benign
Transcript: ENSMUST00000028522
AA Change: T617A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028522
Gene: ENSMUSG00000027111
AA Change: T617A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 5e-32 SMART
SCOP:d1m1xa3 797 1017 3e-55 SMART
Pfam:Integrin_alpha 1038 1052 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112101
AA Change: T617A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107729
Gene: ENSMUSG00000027111
AA Change: T617A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 4e-32 SMART
SCOP:d1m1xa3 797 1017 4e-55 SMART
low complexity region 1058 1070 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155249
AA Change: T210A
SMART Domains Protein: ENSMUSP00000118086
Gene: ENSMUSG00000027111
AA Change: T210A

DomainStartEndE-ValueType
Pfam:Integrin_alpha2 58 533 4.7e-131 PFAM
transmembrane domain 609 631 N/A INTRINSIC
Pfam:Integrin_alpha 632 646 6.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155596
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 4 to bind laminin and to form the main component of hemidesmosomes, which mediate attachment of epithelia to basement membranes. In mouse, deficiency of this gene is associated with absence of hemidesmosomes, severe skin blistering, and early post-natal death. In humans mutations of this gene are associated with epidermolysis bullosa. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe blistering of the skin and other epithelia, absence of hemidesmosomes, altered laminin deposition in brain, and ectopic neuroblastic outgrowths on the brain and in the eye. Mutants die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Itga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Itga6 APN 2 71838262 splice site probably null
IGL00902:Itga6 APN 2 71849394 missense probably benign 0.39
IGL01360:Itga6 APN 2 71787326 splice site probably null
IGL01621:Itga6 APN 2 71825656 missense probably benign 0.02
IGL01877:Itga6 APN 2 71838280 missense probably benign
IGL02332:Itga6 APN 2 71838373 missense possibly damaging 0.63
IGL02556:Itga6 APN 2 71838683 missense probably benign 0.20
IGL02713:Itga6 APN 2 71816713 missense possibly damaging 0.79
IGL02811:Itga6 APN 2 71826732 missense probably damaging 0.98
IGL03171:Itga6 APN 2 71841329 critical splice donor site probably null
isle_royale UTSW 2 71787233 missense probably benign 0.04
PIT4418001:Itga6 UTSW 2 71834070 missense probably benign 0.06
R0070:Itga6 UTSW 2 71826716 unclassified probably benign
R0611:Itga6 UTSW 2 71820060 missense possibly damaging 0.84
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1439:Itga6 UTSW 2 71834034 missense probably damaging 1.00
R1487:Itga6 UTSW 2 71843240 missense possibly damaging 0.87
R1713:Itga6 UTSW 2 71787202 missense probably benign
R1720:Itga6 UTSW 2 71820166 missense probably damaging 1.00
R1816:Itga6 UTSW 2 71840809 missense probably benign 0.00
R1866:Itga6 UTSW 2 71834070 missense probably benign
R2009:Itga6 UTSW 2 71816681 missense probably benign 0.26
R2018:Itga6 UTSW 2 71818484 missense probably benign 0.16
R2171:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R2189:Itga6 UTSW 2 71825617 missense probably benign 0.00
R2289:Itga6 UTSW 2 71818529 missense probably damaging 0.99
R2399:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R4437:Itga6 UTSW 2 71825638 missense probably benign 0.42
R4482:Itga6 UTSW 2 71855915 missense probably damaging 1.00
R4773:Itga6 UTSW 2 71822444 missense probably benign 0.13
R4786:Itga6 UTSW 2 71838690 missense possibly damaging 0.80
R4898:Itga6 UTSW 2 71838373 missense possibly damaging 0.77
R5074:Itga6 UTSW 2 71826435 missense probably benign
R5386:Itga6 UTSW 2 71841150 missense probably damaging 1.00
R5591:Itga6 UTSW 2 71840590 missense probably damaging 1.00
R6024:Itga6 UTSW 2 71787233 missense probably benign 0.04
R6174:Itga6 UTSW 2 71833709 missense possibly damaging 0.88
R6210:Itga6 UTSW 2 71834007 critical splice acceptor site probably null
R6432:Itga6 UTSW 2 71833772 missense possibly damaging 0.75
R6644:Itga6 UTSW 2 71841124 missense probably damaging 1.00
R7354:Itga6 UTSW 2 71820230 missense probably damaging 1.00
R7402:Itga6 UTSW 2 71853553 missense probably benign 0.05
R7479:Itga6 UTSW 2 71838336 nonsense probably null
R7635:Itga6 UTSW 2 71843233 missense probably benign 0.00
R7657:Itga6 UTSW 2 71846251 missense probably benign 0.40
R7737:Itga6 UTSW 2 71822443 missense probably benign 0.38
R7782:Itga6 UTSW 2 71841535 missense probably damaging 0.98
R8062:Itga6 UTSW 2 71841743 missense probably benign 0.11
R8312:Itga6 UTSW 2 71855953 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTTTGCAGGAGAACATCAGAGAC -3'
(R):5'- CACAGAATGCACATTTGCTTCCCAC -3'

Sequencing Primer
(F):5'- TCAGAGACAAGCTGCGTC -3'
(R):5'- AAGGTCACCATATGTGGCCA -3'
Posted On2014-03-14