Incidental Mutation 'R1404:Olfr1317'
ID160477
Institutional Source Beutler Lab
Gene Symbol Olfr1317
Ensembl Gene ENSMUSG00000050776
Gene Nameolfactory receptor 1317
SynonymsGA_x6K02T2Q125-73188162-73189112, MOR245-4
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112140329-112144054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112142623 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 226 (R226H)
Ref Sequence ENSEMBL: ENSMUSP00000149091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060098] [ENSMUST00000214801] [ENSMUST00000216988]
Predicted Effect probably benign
Transcript: ENSMUST00000060098
AA Change: R226H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000058587
Gene: ENSMUSG00000050776
AA Change: R226H

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.1e-40 PFAM
Pfam:7tm_1 41 287 5.2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213693
Predicted Effect probably benign
Transcript: ENSMUST00000214801
AA Change: R226H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000216988
AA Change: R226H

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Olfr1317
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03294:Olfr1317 APN 2 112142173 missense probably benign 0.12
R1390:Olfr1317 UTSW 2 112142607 missense probably benign 0.35
R1404:Olfr1317 UTSW 2 112142623 missense probably benign 0.01
R1771:Olfr1317 UTSW 2 112142720 nonsense probably null
R3500:Olfr1317 UTSW 2 112142127 missense possibly damaging 0.64
R3894:Olfr1317 UTSW 2 112142014 missense probably benign 0.04
R4289:Olfr1317 UTSW 2 112141974 missense probably benign 0.28
R5646:Olfr1317 UTSW 2 112142683 missense possibly damaging 0.95
R6336:Olfr1317 UTSW 2 112142406 missense probably benign 0.10
R6439:Olfr1317 UTSW 2 112142164 missense probably benign 0.03
R6450:Olfr1317 UTSW 2 112142380 nonsense probably null
R6737:Olfr1317 UTSW 2 112142203 missense probably damaging 1.00
R7269:Olfr1317 UTSW 2 112142560 missense probably damaging 1.00
R7336:Olfr1317 UTSW 2 112142169 missense possibly damaging 0.80
R7597:Olfr1317 UTSW 2 112142580 missense probably benign 0.05
R8088:Olfr1317 UTSW 2 112142257 missense probably benign 0.45
R8119:Olfr1317 UTSW 2 112142563 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAAAGTCATCTCCTTGAACGG -3'
(R):5'- AGCAAAGAGTCTCCTCATTGCAACC -3'

Sequencing Primer
(F):5'- CATGGCCTATGACAGGTACATTG -3'
(R):5'- TAGATGACAGGATTCATAGAAGGAG -3'
Posted On2014-03-14