Incidental Mutation 'R1404:Fam227b'
ID 160478
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
MMRRC Submission 039466-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1404 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 125825403-125993924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 125845759 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 410 (L410P)
Ref Sequence ENSEMBL: ENSMUSP00000136349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably damaging
Transcript: ENSMUST00000110446
AA Change: L410P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: L410P

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110448
AA Change: L410P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: L410P

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156413
Predicted Effect probably damaging
Transcript: ENSMUST00000178118
AA Change: L410P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: L410P

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1l1 A T 6: 48,952,767 (GRCm39) T231S probably benign Het
Arrdc3 A G 13: 81,031,973 (GRCm39) T69A probably damaging Het
Bbs2 T C 8: 94,808,627 (GRCm39) K360R probably null Het
Cdh8 A T 8: 100,006,250 (GRCm39) N112K probably damaging Het
Ces5a A T 8: 94,228,809 (GRCm39) F474I probably damaging Het
Dync1i1 G A 6: 5,915,876 (GRCm39) D253N probably damaging Het
Fam151b T C 13: 92,610,480 (GRCm39) D103G probably damaging Het
Gm17535 A G 9: 3,035,804 (GRCm39) Y224C probably null Het
Ihh A T 1: 74,990,372 (GRCm39) M1K probably null Het
Itga6 A G 2: 71,669,060 (GRCm39) T617A probably benign Het
Itpr1 T A 6: 108,363,609 (GRCm39) C744S probably benign Het
Kif5a T C 10: 127,081,311 (GRCm39) I208V probably benign Het
Lama4 A G 10: 38,937,387 (GRCm39) K659R probably benign Het
Lpin3 T A 2: 160,734,310 (GRCm39) probably null Het
Macf1 T A 4: 123,270,309 (GRCm39) E6612V probably damaging Het
Ncdn T C 4: 126,643,833 (GRCm39) K330E probably benign Het
Neb C T 2: 52,073,287 (GRCm39) D1975N possibly damaging Het
Nell1 T A 7: 50,503,621 (GRCm39) N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,504,026 (GRCm39) probably benign Het
Or4f47 G A 2: 111,972,968 (GRCm39) R226H probably benign Het
Rnf43 A G 11: 87,625,003 (GRCm39) E737G possibly damaging Het
Sardh C A 2: 27,129,473 (GRCm39) W275L probably damaging Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Sipa1l2 G A 8: 126,176,712 (GRCm39) H1185Y probably damaging Het
Skp2 G A 15: 9,117,012 (GRCm39) Q298* probably null Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Stx12 T A 4: 132,598,960 (GRCm39) I43L probably benign Het
Tmc1 T A 19: 20,793,548 (GRCm39) I538F possibly damaging Het
Tollip T C 7: 141,438,292 (GRCm39) M209V probably benign Het
Ttn A T 2: 76,643,312 (GRCm39) S13202R probably damaging Het
Vmn2r60 T A 7: 41,786,211 (GRCm39) V338D probably damaging Het
Vwa8 T C 14: 79,263,471 (GRCm39) L767P probably damaging Het
Zfp202 C T 9: 40,122,792 (GRCm39) T518I probably damaging Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 125,986,245 (GRCm39) critical splice acceptor site probably null
IGL00970:Fam227b APN 2 125,968,980 (GRCm39) missense probably benign 0.01
IGL02040:Fam227b APN 2 125,963,004 (GRCm39) splice site probably benign
IGL02095:Fam227b APN 2 125,942,924 (GRCm39) missense probably damaging 0.97
IGL02352:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02359:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02506:Fam227b APN 2 125,845,831 (GRCm39) missense probably benign 0.22
IGL02717:Fam227b APN 2 125,845,763 (GRCm39) missense probably null 0.97
IGL02933:Fam227b APN 2 125,965,908 (GRCm39) splice site probably null
IGL03064:Fam227b APN 2 125,968,762 (GRCm39) splice site probably null
IGL03086:Fam227b APN 2 125,960,951 (GRCm39) missense probably benign 0.01
IGL03198:Fam227b APN 2 125,966,499 (GRCm39) critical splice donor site probably null
IGL03256:Fam227b APN 2 125,830,923 (GRCm39) missense probably damaging 0.99
IGL03368:Fam227b APN 2 125,960,983 (GRCm39) missense probably damaging 1.00
dana UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0110:Fam227b UTSW 2 125,942,841 (GRCm39) missense probably damaging 1.00
R0140:Fam227b UTSW 2 125,966,523 (GRCm39) missense possibly damaging 0.53
R0377:Fam227b UTSW 2 125,966,920 (GRCm39) splice site probably benign
R0499:Fam227b UTSW 2 125,942,829 (GRCm39) missense probably benign 0.25
R1240:Fam227b UTSW 2 125,966,505 (GRCm39) missense possibly damaging 0.56
R1356:Fam227b UTSW 2 125,960,928 (GRCm39) missense probably damaging 1.00
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R2055:Fam227b UTSW 2 125,942,874 (GRCm39) missense probably benign 0.13
R2884:Fam227b UTSW 2 125,942,846 (GRCm39) missense probably benign 0.01
R3124:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3125:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3937:Fam227b UTSW 2 125,968,980 (GRCm39) missense probably benign 0.01
R4408:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4454:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4455:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4457:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4558:Fam227b UTSW 2 125,968,963 (GRCm39) missense probably benign 0.00
R4661:Fam227b UTSW 2 125,849,230 (GRCm39) missense probably damaging 0.99
R4809:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125,829,859 (GRCm39) missense probably benign 0.01
R4989:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5011:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5013:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5014:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5133:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5184:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5431:Fam227b UTSW 2 125,968,851 (GRCm39) missense probably benign 0.09
R5797:Fam227b UTSW 2 125,849,254 (GRCm39) missense probably benign
R6056:Fam227b UTSW 2 125,962,972 (GRCm39) missense probably damaging 1.00
R6218:Fam227b UTSW 2 125,968,882 (GRCm39) missense probably damaging 1.00
R6471:Fam227b UTSW 2 125,962,985 (GRCm39) missense probably damaging 1.00
R6660:Fam227b UTSW 2 125,986,227 (GRCm39) missense probably damaging 1.00
R6734:Fam227b UTSW 2 125,968,896 (GRCm39) nonsense probably null
R7136:Fam227b UTSW 2 125,965,948 (GRCm39) missense probably damaging 0.99
R7410:Fam227b UTSW 2 125,960,983 (GRCm39) missense probably damaging 1.00
R8417:Fam227b UTSW 2 125,962,982 (GRCm39) missense probably damaging 1.00
R8679:Fam227b UTSW 2 125,830,928 (GRCm39) missense probably benign 0.02
R8731:Fam227b UTSW 2 125,968,898 (GRCm39) missense possibly damaging 0.95
R8986:Fam227b UTSW 2 125,958,019 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTCAGCCAATTGTGCTGCC -3'
(R):5'- AGTGTCAGTGACCTGTGCCTTTTC -3'

Sequencing Primer
(F):5'- CAATTGTGCTGCCGAGGTAAAC -3'
(R):5'- GACCTGTGCCTTTTCCTCCC -3'
Posted On 2014-03-14