Incidental Mutation 'R1404:Lpin3'
ID 160480
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Name lipin 3
Synonyms 9130206L11Rik
MMRRC Submission 039466-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1404 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 160722590-160747920 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 160734310 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000040872] [ENSMUST00000040872] [ENSMUST00000040872] [ENSMUST00000040872] [ENSMUST00000109455] [ENSMUST00000109455] [ENSMUST00000109455] [ENSMUST00000109455] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109456] [ENSMUST00000109456] [ENSMUST00000109456] [ENSMUST00000109456] [ENSMUST00000109457] [ENSMUST00000109457] [ENSMUST00000109457] [ENSMUST00000109457] [ENSMUST00000109457]
AlphaFold Q99PI4
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142212
Meta Mutation Damage Score 0.9500 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1l1 A T 6: 48,952,767 (GRCm39) T231S probably benign Het
Arrdc3 A G 13: 81,031,973 (GRCm39) T69A probably damaging Het
Bbs2 T C 8: 94,808,627 (GRCm39) K360R probably null Het
Cdh8 A T 8: 100,006,250 (GRCm39) N112K probably damaging Het
Ces5a A T 8: 94,228,809 (GRCm39) F474I probably damaging Het
Dync1i1 G A 6: 5,915,876 (GRCm39) D253N probably damaging Het
Fam151b T C 13: 92,610,480 (GRCm39) D103G probably damaging Het
Fam227b A G 2: 125,845,759 (GRCm39) L410P probably damaging Het
Gm17535 A G 9: 3,035,804 (GRCm39) Y224C probably null Het
Ihh A T 1: 74,990,372 (GRCm39) M1K probably null Het
Itga6 A G 2: 71,669,060 (GRCm39) T617A probably benign Het
Itpr1 T A 6: 108,363,609 (GRCm39) C744S probably benign Het
Kif5a T C 10: 127,081,311 (GRCm39) I208V probably benign Het
Lama4 A G 10: 38,937,387 (GRCm39) K659R probably benign Het
Macf1 T A 4: 123,270,309 (GRCm39) E6612V probably damaging Het
Ncdn T C 4: 126,643,833 (GRCm39) K330E probably benign Het
Neb C T 2: 52,073,287 (GRCm39) D1975N possibly damaging Het
Nell1 T A 7: 50,503,621 (GRCm39) N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,504,026 (GRCm39) probably benign Het
Or4f47 G A 2: 111,972,968 (GRCm39) R226H probably benign Het
Rnf43 A G 11: 87,625,003 (GRCm39) E737G possibly damaging Het
Sardh C A 2: 27,129,473 (GRCm39) W275L probably damaging Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,127,419 (GRCm39) probably benign Het
Sipa1l2 G A 8: 126,176,712 (GRCm39) H1185Y probably damaging Het
Skp2 G A 15: 9,117,012 (GRCm39) Q298* probably null Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Stx12 T A 4: 132,598,960 (GRCm39) I43L probably benign Het
Tmc1 T A 19: 20,793,548 (GRCm39) I538F possibly damaging Het
Tollip T C 7: 141,438,292 (GRCm39) M209V probably benign Het
Ttn A T 2: 76,643,312 (GRCm39) S13202R probably damaging Het
Vmn2r60 T A 7: 41,786,211 (GRCm39) V338D probably damaging Het
Vwa8 T C 14: 79,263,471 (GRCm39) L767P probably damaging Het
Zfp202 C T 9: 40,122,792 (GRCm39) T518I probably damaging Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160,735,918 (GRCm39) missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160,745,649 (GRCm39) missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160,739,047 (GRCm39) missense probably benign 0.02
IGL02124:Lpin3 APN 2 160,737,753 (GRCm39) critical splice donor site probably null
IGL02272:Lpin3 APN 2 160,743,581 (GRCm39) missense probably benign 0.15
IGL02314:Lpin3 APN 2 160,740,638 (GRCm39) nonsense probably null
IGL02374:Lpin3 APN 2 160,737,758 (GRCm39) splice site probably benign
IGL02554:Lpin3 APN 2 160,738,707 (GRCm39) missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160,746,975 (GRCm39) missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160,740,540 (GRCm39) splice site probably benign
IGL03143:Lpin3 APN 2 160,745,518 (GRCm39) splice site probably benign
R0100:Lpin3 UTSW 2 160,747,260 (GRCm39) missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160,747,260 (GRCm39) missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160,740,601 (GRCm39) missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160,740,601 (GRCm39) missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160,747,225 (GRCm39) missense probably benign
R0330:Lpin3 UTSW 2 160,747,225 (GRCm39) missense probably benign
R0570:Lpin3 UTSW 2 160,745,944 (GRCm39) splice site probably benign
R0633:Lpin3 UTSW 2 160,745,894 (GRCm39) missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160,735,999 (GRCm39) missense probably benign 0.03
R1109:Lpin3 UTSW 2 160,740,941 (GRCm39) missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160,735,999 (GRCm39) missense probably benign 0.03
R1404:Lpin3 UTSW 2 160,734,310 (GRCm39) critical splice donor site probably null
R1513:Lpin3 UTSW 2 160,746,468 (GRCm39) missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160,737,310 (GRCm39) missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160,738,729 (GRCm39) nonsense probably null
R1786:Lpin3 UTSW 2 160,738,729 (GRCm39) nonsense probably null
R1896:Lpin3 UTSW 2 160,747,218 (GRCm39) missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160,740,565 (GRCm39) missense probably benign
R4470:Lpin3 UTSW 2 160,737,354 (GRCm39) missense probably benign 0.00
R4996:Lpin3 UTSW 2 160,747,207 (GRCm39) missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160,746,748 (GRCm39) missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160,738,981 (GRCm39) missense probably benign
R5184:Lpin3 UTSW 2 160,739,058 (GRCm39) missense probably benign
R5405:Lpin3 UTSW 2 160,745,849 (GRCm39) missense probably damaging 1.00
R5442:Lpin3 UTSW 2 160,746,936 (GRCm39) missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160,739,250 (GRCm39) missense probably benign
R5670:Lpin3 UTSW 2 160,739,250 (GRCm39) missense probably benign
R5693:Lpin3 UTSW 2 160,737,320 (GRCm39) missense probably benign 0.00
R6084:Lpin3 UTSW 2 160,737,721 (GRCm39) missense probably benign 0.38
R6994:Lpin3 UTSW 2 160,746,803 (GRCm39) missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160,738,672 (GRCm39) missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160,740,627 (GRCm39) missense probably benign 0.02
R7207:Lpin3 UTSW 2 160,735,923 (GRCm39) nonsense probably null
R7430:Lpin3 UTSW 2 160,740,586 (GRCm39) missense probably benign 0.06
R7459:Lpin3 UTSW 2 160,739,220 (GRCm39) missense probably benign 0.06
R7603:Lpin3 UTSW 2 160,745,674 (GRCm39) splice site probably null
R7644:Lpin3 UTSW 2 160,738,690 (GRCm39) missense probably benign 0.02
R7706:Lpin3 UTSW 2 160,747,210 (GRCm39) missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160,737,310 (GRCm39) missense possibly damaging 0.69
R8443:Lpin3 UTSW 2 160,737,273 (GRCm39) missense probably damaging 1.00
R8985:Lpin3 UTSW 2 160,738,674 (GRCm39) missense probably benign 0.00
R9288:Lpin3 UTSW 2 160,745,552 (GRCm39) missense probably damaging 1.00
R9385:Lpin3 UTSW 2 160,738,993 (GRCm39) missense probably benign
R9455:Lpin3 UTSW 2 160,737,259 (GRCm39) missense probably benign 0.02
R9482:Lpin3 UTSW 2 160,746,416 (GRCm39) missense probably damaging 1.00
R9700:Lpin3 UTSW 2 160,740,565 (GRCm39) missense probably benign 0.11
R9732:Lpin3 UTSW 2 160,734,196 (GRCm39) missense probably damaging 1.00
X0002:Lpin3 UTSW 2 160,745,637 (GRCm39) missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160,734,151 (GRCm39) missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160,741,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGTTTGGAACGGTTAAGGAGC -3'
(R):5'- GTGAGGTGATTTAGCACGGTCACAG -3'

Sequencing Primer
(F):5'- CTGGTGGTAAGGCAGCG -3'
(R):5'- gctcagcaggaaatggcac -3'
Posted On 2014-03-14