Incidental Mutation 'R1404:Stk4'
ID160481
Institutional Source Beutler Lab
Gene Symbol Stk4
Ensembl Gene ENSMUSG00000018209
Gene Nameserine/threonine kinase 4
SynonymsYsk3, sterile 20-like kinase 1, Kas-2, Mst1
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location164070322-164155524 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164100528 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 360 (T360M)
Ref Sequence ENSEMBL: ENSMUSP00000018353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018353]
Predicted Effect probably benign
Transcript: ENSMUST00000018353
AA Change: T360M

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000018353
Gene: ENSMUSG00000018209
AA Change: T360M

DomainStartEndE-ValueType
S_TKc 30 281 1.97e-104 SMART
low complexity region 311 326 N/A INTRINSIC
Pfam:Mst1_SARAH 433 480 2.4e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137866
AA Change: T75M
SMART Domains Protein: ENSMUSP00000116745
Gene: ENSMUSG00000018209
AA Change: T75M

DomainStartEndE-ValueType
Blast:S_TKc 2 26 8e-6 BLAST
PDB:3COM|B 2 26 4e-7 PDB
low complexity region 27 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153319
Meta Mutation Damage Score 0.1297 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele have low numbers of na�ve T cells that are hyper-responsive to stimulation. Mice homozygous for knock-out alleles exhibit decreased peripheral T cell numbers due to impaired emigration and homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Stk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Stk4 APN 2 164118079 missense probably benign 0.05
IGL01583:Stk4 APN 2 164074214 start codon destroyed probably null 0.21
IGL01933:Stk4 APN 2 164098585 unclassified probably benign
IGL02084:Stk4 APN 2 164086607 missense probably benign 0.05
IGL02423:Stk4 APN 2 164086499 missense probably benign 0.00
IGL02601:Stk4 APN 2 164086542 missense probably damaging 1.00
IGL02712:Stk4 APN 2 164096897 missense probably damaging 1.00
hallon UTSW 2 164099827 critical splice donor site probably null
iwo_jima UTSW 2 164088959 missense possibly damaging 0.94
ribeye UTSW 2 164079566 missense probably damaging 1.00
Sergeant UTSW 2 164099712 missense probably benign
stryker UTSW 2 164083688 nonsense probably null
R0377:Stk4 UTSW 2 164096800 missense probably damaging 1.00
R0607:Stk4 UTSW 2 164098542 missense probably damaging 1.00
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1403:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1404:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1405:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1406:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1972:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1973:Stk4 UTSW 2 164100528 missense probably benign 0.04
R1976:Stk4 UTSW 2 164100528 missense probably benign 0.04
R2025:Stk4 UTSW 2 164096831 missense probably damaging 1.00
R3155:Stk4 UTSW 2 164151743 missense probably benign 0.01
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3732:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3733:Stk4 UTSW 2 164088908 missense probably benign 0.05
R3734:Stk4 UTSW 2 164088908 missense probably benign 0.05
R4288:Stk4 UTSW 2 164099712 missense probably benign
R4296:Stk4 UTSW 2 164117984 missense possibly damaging 0.69
R4360:Stk4 UTSW 2 164088959 missense possibly damaging 0.94
R4829:Stk4 UTSW 2 164099827 critical splice donor site probably null
R4954:Stk4 UTSW 2 164151681 missense possibly damaging 0.75
R4954:Stk4 UTSW 2 164151682 missense probably damaging 1.00
R5088:Stk4 UTSW 2 164083688 nonsense probably null
R5188:Stk4 UTSW 2 164088908 missense possibly damaging 0.85
R5283:Stk4 UTSW 2 164110279 nonsense probably null
R5554:Stk4 UTSW 2 164099725 missense probably benign
R5605:Stk4 UTSW 2 164079566 missense probably damaging 1.00
R5694:Stk4 UTSW 2 164100564 missense possibly damaging 0.87
R5711:Stk4 UTSW 2 164099754 missense probably benign 0.20
R7453:Stk4 UTSW 2 164086602 missense probably benign 0.01
R7698:Stk4 UTSW 2 164083743 missense probably damaging 1.00
R7726:Stk4 UTSW 2 164110226 start codon destroyed probably null
R8177:Stk4 UTSW 2 164088857 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTTGCACCGAGAGTAACCGTGAC -3'
(R):5'- TGAGAGCATTCAGACGAAGCTCCC -3'

Sequencing Primer
(F):5'- GTAACCGTGACTCAGGACG -3'
(R):5'- TCTCTCCCTCTAAGGGACGTAG -3'
Posted On2014-03-14