Incidental Mutation 'R1404:Dync1i1'
ID160486
Institutional Source Beutler Lab
Gene Symbol Dync1i1
Ensembl Gene ENSMUSG00000029757
Gene Namedynein cytoplasmic 1 intermediate chain 1
SynonymsIC74, Dncic1, DIC
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location5725639-6028039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5915876 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 253 (D253N)
Ref Sequence ENSEMBL: ENSMUSP00000111218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115554] [ENSMUST00000115555] [ENSMUST00000115556] [ENSMUST00000115559]
Predicted Effect probably damaging
Transcript: ENSMUST00000115554
AA Change: D244N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111216
Gene: ENSMUSG00000029757
AA Change: D244N

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 105 137 3.1e-20 PFAM
low complexity region 143 150 N/A INTRINSIC
Blast:WD40 235 288 2e-26 BLAST
WD40 293 332 9.6e-2 SMART
WD40 339 382 8.91e-1 SMART
WD40 436 481 4.48e-2 SMART
WD40 484 524 6.19e-1 SMART
WD40 529 569 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115555
AA Change: D281N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111217
Gene: ENSMUSG00000029757
AA Change: D281N

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 92 107 N/A INTRINSIC
Pfam:Dynein_IC2 143 173 6.9e-18 PFAM
low complexity region 180 187 N/A INTRINSIC
Blast:WD40 272 325 4e-26 BLAST
WD40 330 369 9.6e-2 SMART
WD40 376 419 8.91e-1 SMART
WD40 473 518 4.48e-2 SMART
WD40 521 561 6.19e-1 SMART
WD40 566 606 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115556
AA Change: D253N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111218
Gene: ENSMUSG00000029757
AA Change: D253N

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Dynein_IC2 114 146 9.2e-21 PFAM
low complexity region 152 159 N/A INTRINSIC
Blast:WD40 245 297 3e-26 BLAST
WD40 302 341 9.6e-2 SMART
WD40 348 391 8.91e-1 SMART
WD40 445 490 4.48e-2 SMART
WD40 493 533 6.19e-1 SMART
WD40 538 578 7.67e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115559
AA Change: D264N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111221
Gene: ENSMUSG00000029757
AA Change: D264N

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:Dynein_IC2 125 157 2e-20 PFAM
low complexity region 163 170 N/A INTRINSIC
Blast:WD40 256 308 3e-26 BLAST
WD40 313 352 9.6e-2 SMART
WD40 359 402 8.91e-1 SMART
WD40 456 501 4.48e-2 SMART
WD40 504 544 6.19e-1 SMART
WD40 549 589 7.67e0 SMART
Meta Mutation Damage Score 0.1725 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Dync1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Dync1i1 APN 6 5972135 missense probably damaging 1.00
IGL01816:Dync1i1 APN 6 5767146 critical splice donor site probably null
IGL02171:Dync1i1 APN 6 5969498 missense probably damaging 0.98
IGL02646:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02672:Dync1i1 APN 6 5767034 missense probably benign 0.12
IGL02691:Dync1i1 APN 6 5800767 splice site probably benign
IGL02880:Dync1i1 APN 6 5966821 splice site probably null
IGL02796:Dync1i1 UTSW 6 5757385 missense probably benign 0.00
R0519:Dync1i1 UTSW 6 6027399 missense probably benign
R1404:Dync1i1 UTSW 6 5915876 missense probably damaging 1.00
R1499:Dync1i1 UTSW 6 5769799 splice site probably benign
R2119:Dync1i1 UTSW 6 5767096 missense probably damaging 0.97
R3177:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R3277:Dync1i1 UTSW 6 5972211 critical splice donor site probably null
R4028:Dync1i1 UTSW 6 5961842 missense probably damaging 1.00
R4058:Dync1i1 UTSW 6 5769764 missense probably damaging 0.99
R4551:Dync1i1 UTSW 6 5923206 missense probably benign 0.01
R4748:Dync1i1 UTSW 6 5767048 missense possibly damaging 0.66
R5263:Dync1i1 UTSW 6 5969446 missense possibly damaging 0.88
R6193:Dync1i1 UTSW 6 5730679 missense probably benign 0.03
R6280:Dync1i1 UTSW 6 5972084 missense probably benign 0.00
R6933:Dync1i1 UTSW 6 5913333 missense probably damaging 1.00
R7083:Dync1i1 UTSW 6 5969429 missense probably damaging 1.00
R7347:Dync1i1 UTSW 6 5784530 makesense probably null
R7512:Dync1i1 UTSW 6 5969410 missense possibly damaging 0.88
R7543:Dync1i1 UTSW 6 5784464 missense possibly damaging 0.93
R7601:Dync1i1 UTSW 6 5905129 missense probably benign 0.19
X0010:Dync1i1 UTSW 6 5972141 missense probably benign 0.06
Z1177:Dync1i1 UTSW 6 5767057 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACTGAACTTTGGATAGCAGACCCAC -3'
(R):5'- CGTAGAAGAGCTTACTTCACGGAATGG -3'

Sequencing Primer
(F):5'- TAAAAGCCTTTCTGAGCCGGTAG -3'
(R):5'- TCTGAATGGATAATTAGCCCCC -3'
Posted On2014-03-14