Incidental Mutation 'R1404:Nell1'
ID160490
Institutional Source Beutler Lab
Gene Symbol Nell1
Ensembl Gene ENSMUSG00000055409
Gene NameNEL-like 1
SynonymsB230343H07Rik, l7R6
MMRRC Submission 039466-MU
Accession Numbers

Genbank: NM_001037906; MGI: 2443902

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location49974864-50866608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50853873 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 675 (N675K)
Ref Sequence ENSEMBL: ENSMUSP00000080550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081872
AA Change: N675K

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: N675K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107603
AA Change: N628K

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: N628K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Meta Mutation Damage Score 0.2342 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype Strain: 3626314
Lethality: E19-E21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Nell1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Nell1 APN 7 50120673 missense probably damaging 0.96
IGL01434:Nell1 APN 7 50701208 missense probably benign 0.01
IGL01796:Nell1 APN 7 50176216 splice site probably benign
IGL02048:Nell1 APN 7 50219607 missense probably damaging 0.96
IGL02239:Nell1 APN 7 50249650 missense probably benign 0.08
IGL02860:Nell1 APN 7 50848485 missense probably damaging 0.99
IGL02958:Nell1 APN 7 50220337 critical splice donor site probably null
IGL03143:Nell1 APN 7 50279533 nonsense probably null
IGL03334:Nell1 APN 7 50062611 splice site probably null
D6062:Nell1 UTSW 7 50258191 missense probably benign 0.21
P0018:Nell1 UTSW 7 50120691 missense probably damaging 1.00
R0004:Nell1 UTSW 7 50560759 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0029:Nell1 UTSW 7 50120715 splice site probably benign
R0468:Nell1 UTSW 7 50228846 missense probably damaging 0.97
R0483:Nell1 UTSW 7 50230180 missense probably benign 0.07
R0732:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R0945:Nell1 UTSW 7 50219585 missense probably benign 0.07
R1022:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1024:Nell1 UTSW 7 50120663 missense probably damaging 1.00
R1075:Nell1 UTSW 7 50853840 missense probably damaging 0.98
R1291:Nell1 UTSW 7 50230250 missense probably benign 0.00
R1404:Nell1 UTSW 7 50853873 missense possibly damaging 0.91
R1634:Nell1 UTSW 7 50848558 missense possibly damaging 0.82
R1928:Nell1 UTSW 7 50701195 missense possibly damaging 0.51
R2060:Nell1 UTSW 7 50560830 missense possibly damaging 0.58
R2261:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2262:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2263:Nell1 UTSW 7 50560821 missense possibly damaging 0.95
R2448:Nell1 UTSW 7 50856387 missense probably damaging 1.00
R2869:Nell1 UTSW 7 50249657 intron probably benign
R2870:Nell1 UTSW 7 50249657 intron probably benign
R2871:Nell1 UTSW 7 50249657 intron probably benign
R3498:Nell1 UTSW 7 50258179 missense possibly damaging 0.55
R4044:Nell1 UTSW 7 50219619 missense probably damaging 1.00
R4623:Nell1 UTSW 7 50120562 missense possibly damaging 0.84
R4732:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4733:Nell1 UTSW 7 50856217 missense probably damaging 1.00
R4941:Nell1 UTSW 7 50062638 missense probably benign 0.10
R4942:Nell1 UTSW 7 50120649 missense possibly damaging 0.84
R5233:Nell1 UTSW 7 50176314 missense probably damaging 0.99
R5590:Nell1 UTSW 7 50279611 missense probably damaging 1.00
R5673:Nell1 UTSW 7 50228846 missense probably damaging 0.99
R5741:Nell1 UTSW 7 50560890 unclassified probably null
R6345:Nell1 UTSW 7 49975423 missense possibly damaging 0.91
R6916:Nell1 UTSW 7 50701179 missense probably benign 0.00
R7051:Nell1 UTSW 7 50448844 missense unknown
R7302:Nell1 UTSW 7 50856269 missense probably benign
R7339:Nell1 UTSW 7 50279549 missense probably benign 0.01
R7831:Nell1 UTSW 7 49982800 missense possibly damaging 0.85
R7913:Nell1 UTSW 7 50279522 missense possibly damaging 0.93
R8094:Nell1 UTSW 7 50120587 missense probably benign 0.02
R8191:Nell1 UTSW 7 50448874 missense unknown
R8292:Nell1 UTSW 7 50258247 missense probably damaging 1.00
Z1176:Nell1 UTSW 7 50560882 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTGTGCCTGCTTTGAACAAGATG -3'
(R):5'- TGGAACTCCTGCCCAAAAGCTC -3'

Sequencing Primer
(F):5'- CCTGCTTTGAACAAGATGGGAAG -3'
(R):5'- TAACGTTTTCTACAGTAAAGGCACC -3'
Posted On2014-03-14