Incidental Mutation 'R1404:Tollip'
ID 160491
Institutional Source Beutler Lab
Gene Symbol Tollip
Ensembl Gene ENSMUSG00000025139
Gene Name toll interacting protein
Synonyms 4930403G24Rik, Toll interacting protein, 4931428G15Rik
MMRRC Submission 039466-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R1404 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 141874813-141918507 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141884555 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 209 (M209V)
Ref Sequence ENSEMBL: ENSMUSP00000117938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001950] [ENSMUST00000055819] [ENSMUST00000130439] [ENSMUST00000151890]
AlphaFold Q9QZ06
Predicted Effect probably benign
Transcript: ENSMUST00000001950
AA Change: M213V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001950
Gene: ENSMUSG00000025139
AA Change: M213V

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
low complexity region 213 225 N/A INTRINSIC
CUE 229 271 1.43e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055819
SMART Domains Protein: ENSMUSP00000051485
Gene: ENSMUSG00000025139

DomainStartEndE-ValueType
low complexity region 28 44 N/A INTRINSIC
C2 54 151 1.32e-6 SMART
low complexity region 175 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130439
AA Change: M209V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117938
Gene: ENSMUSG00000025139
AA Change: M209V

DomainStartEndE-ValueType
low complexity region 24 40 N/A INTRINSIC
Pfam:C2 51 115 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151890
AA Change: M144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118336
Gene: ENSMUSG00000025139
AA Change: M144V

DomainStartEndE-ValueType
Pfam:C2 1 66 1.9e-8 PFAM
low complexity region 106 121 N/A INTRINSIC
low complexity region 144 156 N/A INTRINSIC
CUE 160 202 1.43e-15 SMART
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-binding protein that interacts with several Toll-like receptor (TLR) signaling cascade components. The encoded protein regulates inflammatory signaling and is involved in interleukin-1 receptor trafficking and in the turnover of IL1R-associated kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display normal immune cell composition but reduced cytokine production when stimulated with low concentrations of some inducers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Tollip
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1404:Tollip UTSW 7 141884555 missense probably benign 0.00
R1742:Tollip UTSW 7 141892855 missense probably damaging 1.00
R2443:Tollip UTSW 7 141890823 nonsense probably null
R4092:Tollip UTSW 7 141884443 missense probably damaging 1.00
R5192:Tollip UTSW 7 141892117 missense probably damaging 1.00
R5614:Tollip UTSW 7 141892088 missense probably damaging 1.00
R6132:Tollip UTSW 7 141889597 missense probably benign 0.37
R6805:Tollip UTSW 7 141890845 missense probably benign 0.21
R6830:Tollip UTSW 7 141898714 start codon destroyed probably null 0.00
R7366:Tollip UTSW 7 141889597 missense probably benign 0.37
R7509:Tollip UTSW 7 141892141 missense probably benign 0.36
R7759:Tollip UTSW 7 141884539 missense probably benign
R8024:Tollip UTSW 7 141892826 missense probably benign
R9574:Tollip UTSW 7 141891994 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTGATGGCAGCATCTTTGTTCCC -3'
(R):5'- CCAGTCAGATTAAGGTAGCCTTTTCCC -3'

Sequencing Primer
(F):5'- CTCTCTGGGCTTCAAGCAC -3'
(R):5'- GATCCCACTGTCTctgtcctg -3'
Posted On 2014-03-14