Incidental Mutation 'R1404:Ces5a'
ID160492
Institutional Source Beutler Lab
Gene Symbol Ces5a
Ensembl Gene ENSMUSG00000058019
Gene Namecarboxylesterase 5A
SynonymsCes7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93499064-93535830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93502181 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 474 (F474I)
Ref Sequence ENSEMBL: ENSMUSP00000148481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009]
Predicted Effect probably damaging
Transcript: ENSMUST00000077816
AA Change: F474I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: F474I

DomainStartEndE-ValueType
Pfam:COesterase 10 539 3.2e-157 PFAM
Pfam:Abhydrolase_3 141 238 9.5e-7 PFAM
low complexity region 552 575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080391
SMART Domains Protein: ENSMUSP00000079254
Gene: ENSMUSG00000058019

DomainStartEndE-ValueType
Pfam:COesterase 83 208 2.3e-23 PFAM
low complexity region 221 244 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212009
AA Change: F474I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212690
Meta Mutation Damage Score 0.3291 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Ces5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces5a APN 8 93525544 critical splice donor site probably null
IGL01520:Ces5a APN 8 93519578 missense probably benign 0.08
IGL01674:Ces5a APN 8 93502219 missense probably damaging 1.00
IGL02257:Ces5a APN 8 93525598 missense probably benign 0.00
IGL02456:Ces5a APN 8 93528644 splice site probably benign
IGL03027:Ces5a APN 8 93523114 unclassified probably null
IGL03051:Ces5a APN 8 93528598 missense probably damaging 1.00
IGL03264:Ces5a APN 8 93502270 missense possibly damaging 0.74
IGL03290:Ces5a APN 8 93519632 missense probably damaging 1.00
R0115:Ces5a UTSW 8 93502183 missense probably damaging 0.98
R0124:Ces5a UTSW 8 93528555 missense probably damaging 1.00
R0521:Ces5a UTSW 8 93525658 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1524:Ces5a UTSW 8 93525665 missense probably damaging 0.96
R1843:Ces5a UTSW 8 93514231 missense probably damaging 1.00
R2029:Ces5a UTSW 8 93534577 missense probably damaging 1.00
R2135:Ces5a UTSW 8 93499741 missense probably benign 0.33
R2146:Ces5a UTSW 8 93534699 missense probably benign 0.03
R2973:Ces5a UTSW 8 93528504 missense probably damaging 1.00
R3755:Ces5a UTSW 8 93528502 missense probably benign 0.15
R4755:Ces5a UTSW 8 93535677 missense probably benign 0.39
R5072:Ces5a UTSW 8 93534668 missense probably damaging 1.00
R5278:Ces5a UTSW 8 93525638 missense probably damaging 1.00
R5419:Ces5a UTSW 8 93499431 missense unknown
R5825:Ces5a UTSW 8 93525667 missense probably damaging 1.00
R6318:Ces5a UTSW 8 93534583 missense probably damaging 1.00
R6925:Ces5a UTSW 8 93523057 intron probably null
R6950:Ces5a UTSW 8 93530774 missense probably benign 0.10
R7148:Ces5a UTSW 8 93502322 missense probably damaging 1.00
R7256:Ces5a UTSW 8 93499526 missense probably benign 0.13
R7290:Ces5a UTSW 8 93534683 missense probably damaging 1.00
R7459:Ces5a UTSW 8 93535741 start gained probably benign
R7674:Ces5a UTSW 8 93514269 missense probably damaging 1.00
R7815:Ces5a UTSW 8 93520995 missense possibly damaging 0.79
R8150:Ces5a UTSW 8 93530802 missense probably damaging 1.00
X0024:Ces5a UTSW 8 93514213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATATGAAATCCCATCCGCTCAG -3'
(R):5'- ACTAGGGGTAAGGTGACTGCCATAG -3'

Sequencing Primer
(F):5'- GCGCTCAGCTCTTACTGAC -3'
(R):5'- aggaaggtaggcaggcag -3'
Posted On2014-03-14