Incidental Mutation 'R1404:Bbs2'
ID160493
Institutional Source Beutler Lab
Gene Symbol Bbs2
Ensembl Gene ENSMUSG00000031755
Gene NameBardet-Biedl syndrome 2 (human)
Synonyms2410125H22Rik
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.816) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94067954-94098928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94081999 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 360 (K360R)
Ref Sequence ENSEMBL: ENSMUSP00000034206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034206]
Predicted Effect probably null
Transcript: ENSMUST00000034206
AA Change: K360R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000034206
Gene: ENSMUSG00000031755
AA Change: K360R

DomainStartEndE-ValueType
Pfam:BBS2_N 20 161 1.4e-62 PFAM
Pfam:BBS2_Mid 162 272 6.9e-50 PFAM
Pfam:BBS2_C 276 715 2.6e-193 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172347
Meta Mutation Damage Score 0.0762 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse and the similar phenotypes exhibited by mutations in BBS gene family members is likely due to their shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene forms a multiprotein BBSome complex with seven other BBS proteins.[provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice display obesity associated with polyphagia, retinopathy associated with mislocalization of rhodopsin, cilia defects, renal cysts, male sterility, abnormal brain neuroanatomy, reduced salivation and acoustic startle response, an olfactory deficit and abnormal social interaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Bbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Bbs2 APN 8 94089167 critical splice acceptor site probably null
IGL02250:Bbs2 APN 8 94092426 missense probably benign 0.22
IGL02427:Bbs2 APN 8 94081118 missense possibly damaging 0.92
IGL02810:Bbs2 APN 8 94086911 missense probably benign 0.00
IGL02850:Bbs2 APN 8 94077082 missense probably benign
IGL03050:Bbs2 APN 8 94074413 splice site probably benign
IGL03292:Bbs2 APN 8 94075121 critical splice donor site probably null
rolie UTSW 8 94082364 missense probably damaging 0.96
BB007:Bbs2 UTSW 8 94069997 missense probably damaging 1.00
BB017:Bbs2 UTSW 8 94069997 missense probably damaging 1.00
R0755:Bbs2 UTSW 8 94082080 missense probably benign 0.22
R0835:Bbs2 UTSW 8 94075259 missense probably damaging 1.00
R1404:Bbs2 UTSW 8 94081999 missense probably null 0.01
R1513:Bbs2 UTSW 8 94089844 missense possibly damaging 0.94
R1972:Bbs2 UTSW 8 94081177 splice site probably benign
R4648:Bbs2 UTSW 8 94080879 missense probably damaging 1.00
R4876:Bbs2 UTSW 8 94070160 unclassified probably benign
R4911:Bbs2 UTSW 8 94089115 missense probably damaging 1.00
R4966:Bbs2 UTSW 8 94080807 missense probably damaging 1.00
R4982:Bbs2 UTSW 8 94082354 critical splice donor site probably null
R5202:Bbs2 UTSW 8 94092414 nonsense probably null
R5347:Bbs2 UTSW 8 94092550 missense probably damaging 0.98
R5364:Bbs2 UTSW 8 94074395 missense probably benign 0.00
R5538:Bbs2 UTSW 8 94089763 missense probably damaging 1.00
R5685:Bbs2 UTSW 8 94087433 missense probably damaging 1.00
R5918:Bbs2 UTSW 8 94098303 missense probably damaging 0.98
R5963:Bbs2 UTSW 8 94081031 missense probably benign 0.02
R5964:Bbs2 UTSW 8 94068367 missense probably benign 0.18
R5991:Bbs2 UTSW 8 94098286 missense probably benign 0.24
R6050:Bbs2 UTSW 8 94092532 missense probably damaging 1.00
R6172:Bbs2 UTSW 8 94087411 missense probably benign 0.02
R6241:Bbs2 UTSW 8 94098235 critical splice donor site probably null
R6578:Bbs2 UTSW 8 94077041 missense probably null 0.00
R7330:Bbs2 UTSW 8 94087405 missense possibly damaging 0.78
R7404:Bbs2 UTSW 8 94082364 missense probably damaging 0.96
R7775:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7778:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7824:Bbs2 UTSW 8 94089760 critical splice donor site probably null
R7895:Bbs2 UTSW 8 94081136 missense probably damaging 1.00
R7930:Bbs2 UTSW 8 94069997 missense probably damaging 1.00
R8004:Bbs2 UTSW 8 94082490 missense possibly damaging 0.95
R8084:Bbs2 UTSW 8 94087428 missense probably damaging 1.00
R8305:Bbs2 UTSW 8 94074325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCACCAAGTCTAACTTCATGGCTC -3'
(R):5'- GCCACGTACAGTTAATCTGCTGCTC -3'

Sequencing Primer
(F):5'- ATGGCTCTTCATTCCAGCAGTAG -3'
(R):5'- ATTGATGGTCTGAAGTAGAAGTGGC -3'
Posted On2014-03-14