Incidental Mutation 'R1404:Zfp202'
ID160497
Institutional Source Beutler Lab
Gene Symbol Zfp202
Ensembl Gene ENSMUSG00000025602
Gene Namezinc finger protein 202
SynonymsC130037E22Rik
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40192316-40213604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40211496 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 518 (T518I)
Ref Sequence ENSEMBL: ENSMUSP00000026693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026693] [ENSMUST00000168691] [ENSMUST00000168832]
Predicted Effect probably damaging
Transcript: ENSMUST00000026693
AA Change: T518I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026693
Gene: ENSMUSG00000025602
AA Change: T518I

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 297 1.7e-17 SMART
ZnF_C2H2 391 413 9.44e-2 SMART
ZnF_C2H2 419 441 6.42e-4 SMART
ZnF_C2H2 473 495 3.44e-4 SMART
ZnF_C2H2 501 523 1.47e-3 SMART
ZnF_C2H2 529 551 1.64e-1 SMART
ZnF_C2H2 557 579 3.11e-2 SMART
ZnF_C2H2 585 607 8.47e-4 SMART
ZnF_C2H2 613 635 3.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168691
SMART Domains Protein: ENSMUSP00000130163
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 132 1.03e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168832
SMART Domains Protein: ENSMUSP00000132131
Gene: ENSMUSG00000025602

DomainStartEndE-ValueType
SCAN 42 154 1.19e-75 SMART
KRAB 237 277 5.32e-2 SMART
Meta Mutation Damage Score 0.1314 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Other mutations in Zfp202
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Zfp202 APN 9 40211043 missense probably benign 0.02
IGL01862:Zfp202 APN 9 40211828 missense probably benign 0.39
IGL03069:Zfp202 APN 9 40211399 missense probably damaging 1.00
R0028:Zfp202 UTSW 9 40211752 missense probably damaging 1.00
R0158:Zfp202 UTSW 9 40208916 nonsense probably null
R0278:Zfp202 UTSW 9 40208482 missense probably benign 0.15
R1132:Zfp202 UTSW 9 40211022 missense probably benign 0.00
R1404:Zfp202 UTSW 9 40211496 missense probably damaging 1.00
R1764:Zfp202 UTSW 9 40210466 missense probably benign 0.00
R1928:Zfp202 UTSW 9 40209787 missense probably damaging 1.00
R2929:Zfp202 UTSW 9 40211688 missense possibly damaging 0.94
R3153:Zfp202 UTSW 9 40208438 missense probably benign 0.00
R3948:Zfp202 UTSW 9 40208425 missense probably benign 0.43
R4190:Zfp202 UTSW 9 40211337 missense probably benign 0.00
R4273:Zfp202 UTSW 9 40207494 nonsense probably null
R6181:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6182:Zfp202 UTSW 9 40207342 missense probably damaging 1.00
R6816:Zfp202 UTSW 9 40211813 missense probably damaging 1.00
R6835:Zfp202 UTSW 9 40210235 intron probably null
R7382:Zfp202 UTSW 9 40211505 missense probably damaging 1.00
R7493:Zfp202 UTSW 9 40207344 missense possibly damaging 0.57
R7542:Zfp202 UTSW 9 40211147 missense probably benign 0.12
R7689:Zfp202 UTSW 9 40210533 missense probably benign 0.02
R7832:Zfp202 UTSW 9 40210462 missense possibly damaging 0.92
R8084:Zfp202 UTSW 9 40211242 missense probably benign 0.19
X0012:Zfp202 UTSW 9 40211184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCTCCAAACCGGAAGACTGTG -3'
(R):5'- TGTCTGACAAGGTGATCCCTCCTG -3'

Sequencing Primer
(F):5'- AAGACTGTGGATGGCCCTC -3'
(R):5'- AGTTCCTCACTGAAGCATGG -3'
Posted On2014-03-14