Incidental Mutation 'R1404:Arrdc3'
ID160501
Institutional Source Beutler Lab
Gene Symbol Arrdc3
Ensembl Gene ENSMUSG00000074794
Gene Namearrestin domain containing 3
SynonymsmKIAA1376; AI450344
MMRRC Submission 039466-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location80883384-80896042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80883854 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 69 (T69A)
Ref Sequence ENSEMBL: ENSMUSP00000096957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099356] [ENSMUST00000159690] [ENSMUST00000161441]
Predicted Effect probably damaging
Transcript: ENSMUST00000099356
AA Change: T69A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096957
Gene: ENSMUSG00000074794
AA Change: T69A

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.4e-35 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159090
Predicted Effect probably damaging
Transcript: ENSMUST00000159690
AA Change: T69A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124418
Gene: ENSMUSG00000074794
AA Change: T69A

DomainStartEndE-ValueType
Pfam:Arrestin_N 9 165 3.5e-38 PFAM
Arrestin_C 187 314 1.25e-29 SMART
low complexity region 319 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161006
Predicted Effect probably benign
Transcript: ENSMUST00000161441
SMART Domains Protein: ENSMUSP00000125455
Gene: ENSMUSG00000074794

DomainStartEndE-ValueType
Pfam:Arrestin_C 4 94 2e-10 PFAM
low complexity region 99 111 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
Meta Mutation Damage Score 0.1992 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arrestin family of proteins, which regulate G protein-mediated signaling. The encoded protein is thought to act as a regulator of breast cancer growth and progression by binding to a phosphorylated form of integrin beta4, a tumor-related antigen, targeting the integrin for internalization and degradation. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit resistance to age-related obesity, insulin resistance, and hepatic steatosis. Mice homozygous for a different gene trap allele exhibit resistance to obesity, embryonic lethality when dams are fed a standard chow and dandruff due to very thin skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam151b T C 13: 92,473,972 D103G probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Arrdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Arrdc3 APN 13 80890572 missense probably damaging 1.00
IGL00933:Arrdc3 APN 13 80891055 splice site probably benign
IGL02006:Arrdc3 APN 13 80883774 missense probably damaging 1.00
IGL02009:Arrdc3 APN 13 80893380 missense probably benign 0.20
IGL02272:Arrdc3 APN 13 80891650 splice site probably benign
IGL02634:Arrdc3 APN 13 80890765 missense probably damaging 1.00
IGL03337:Arrdc3 APN 13 80890647 missense probably benign 0.01
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0008:Arrdc3 UTSW 13 80883892 nonsense probably null
R0008:Arrdc3 UTSW 13 80891075 missense probably damaging 1.00
R0838:Arrdc3 UTSW 13 80889247 splice site probably benign
R0843:Arrdc3 UTSW 13 80890803 splice site probably benign
R1211:Arrdc3 UTSW 13 80890698 missense possibly damaging 0.76
R1404:Arrdc3 UTSW 13 80883854 missense probably damaging 1.00
R1992:Arrdc3 UTSW 13 80883689 missense probably damaging 1.00
R4446:Arrdc3 UTSW 13 80889063 intron probably benign
R4540:Arrdc3 UTSW 13 80890671 missense possibly damaging 0.95
R4718:Arrdc3 UTSW 13 80883867 missense possibly damaging 0.48
R5138:Arrdc3 UTSW 13 80891065 missense probably damaging 1.00
R5814:Arrdc3 UTSW 13 80890579 missense possibly damaging 0.92
R6514:Arrdc3 UTSW 13 80889190 missense probably damaging 1.00
R6899:Arrdc3 UTSW 13 80889211 missense probably damaging 0.99
R6985:Arrdc3 UTSW 13 80883657 missense probably damaging 0.99
R7076:Arrdc3 UTSW 13 80890696 missense probably damaging 1.00
R7670:Arrdc3 UTSW 13 80889093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTGCACGGCAAAGACACCC -3'
(R):5'- CACGCTTGAACGTCAAGGAGAAAC -3'

Sequencing Primer
(F):5'- CACCCATCAGTGTTAAGTGAAG -3'
(R):5'- GGAGAAACTACAGCTTCTAAGTTTGC -3'
Posted On2014-03-14