Incidental Mutation 'R1404:Fam151b'
ID160502
Institutional Source Beutler Lab
Gene Symbol Fam151b
Ensembl Gene ENSMUSG00000034334
Gene Namefamily with sequence similarity 151, member B
Synonyms4930405M20Rik
MMRRC Submission 039466-MU
Accession Numbers

NCBI RefSeq: NM_001163627.1; MGI:1921192

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1404 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location92449625-92484015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92473972 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 103 (D103G)
Ref Sequence ENSEMBL: ENSMUSP00000045024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040106] [ENSMUST00000225299]
Predicted Effect probably damaging
Transcript: ENSMUST00000040106
AA Change: D103G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045024
Gene: ENSMUSG00000034334
AA Change: D103G

DomainStartEndE-ValueType
Pfam:DUF2181 29 263 2.3e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225299
Meta Mutation Damage Score 0.9185 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.4%
  • 10x: 81.1%
  • 20x: 48.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arrdc3 A G 13: 80,883,854 T69A probably damaging Het
Bbs2 T C 8: 94,081,999 K360R probably null Het
Cdh8 A T 8: 99,279,618 N112K probably damaging Het
Ces5a A T 8: 93,502,181 F474I probably damaging Het
Doxl2 A T 6: 48,975,833 T231S probably benign Het
Dync1i1 G A 6: 5,915,876 D253N probably damaging Het
Fam227b A G 2: 126,003,839 L410P probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Ihh A T 1: 74,951,213 M1K probably null Het
Itga6 A G 2: 71,838,716 T617A probably benign Het
Itpr1 T A 6: 108,386,648 C744S probably benign Het
Kif5a T C 10: 127,245,442 I208V probably benign Het
Lama4 A G 10: 39,061,391 K659R probably benign Het
Lpin3 T A 2: 160,892,390 probably null Het
Macf1 T A 4: 123,376,516 E6612V probably damaging Het
Ncdn T C 4: 126,750,040 K330E probably benign Het
Neb C T 2: 52,183,275 D1975N possibly damaging Het
Nell1 T A 7: 50,853,873 N675K possibly damaging Het
Nlrp6 GAGAAGAAGAAGAAGAAGAAGA GAGAAGAAGAAGAAGAAGA 7: 140,924,113 probably benign Het
Olfr1317 G A 2: 112,142,623 R226H probably benign Het
Rnf43 A G 11: 87,734,177 E737G possibly damaging Het
Sardh C A 2: 27,239,461 W275L probably damaging Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sipa1l2 G A 8: 125,449,973 H1185Y probably damaging Het
Skp2 G A 15: 9,116,925 Q298* probably null Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Stx12 T A 4: 132,871,649 I43L probably benign Het
Tmc1 T A 19: 20,816,184 I538F possibly damaging Het
Tollip T C 7: 141,884,555 M209V probably benign Het
Ttn A T 2: 76,812,968 S13202R probably damaging Het
Vmn2r60 T A 7: 42,136,787 V338D probably damaging Het
Vwa8 T C 14: 79,026,031 L767P probably damaging Het
Zfp202 C T 9: 40,211,496 T518I probably damaging Het
Other mutations in Fam151b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Fam151b APN 13 92477853 missense probably damaging 1.00
IGL02253:Fam151b APN 13 92477927 missense probably damaging 1.00
IGL03084:Fam151b APN 13 92468026 missense probably damaging 0.97
IGL03130:Fam151b APN 13 92450193 missense probably benign 0.01
P0015:Fam151b UTSW 13 92467944 critical splice donor site probably null
R0067:Fam151b UTSW 13 92473996 missense probably benign 0.08
R0067:Fam151b UTSW 13 92473996 missense probably benign 0.08
R0348:Fam151b UTSW 13 92450181 missense probably benign 0.00
R1404:Fam151b UTSW 13 92473972 missense probably damaging 1.00
R1482:Fam151b UTSW 13 92450166 missense probably benign 0.03
R1837:Fam151b UTSW 13 92474131 intron probably benign
R1891:Fam151b UTSW 13 92450170 missense probably benign 0.00
R1957:Fam151b UTSW 13 92477902 missense probably damaging 1.00
R1957:Fam151b UTSW 13 92477903 missense probably damaging 1.00
R2175:Fam151b UTSW 13 92477918 missense probably damaging 0.99
R4583:Fam151b UTSW 13 92468109 missense probably damaging 1.00
R6762:Fam151b UTSW 13 92468050 missense possibly damaging 0.79
R8153:Fam151b UTSW 13 92477902 missense probably damaging 1.00
X0021:Fam151b UTSW 13 92450226 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTCCTCAAGGAGCAATCTTAGCCA -3'
(R):5'- GCTGCCCACATGATAGAGGCTGAT -3'

Sequencing Primer
(F):5'- agtctccttttgctgcctg -3'
(R):5'- GATAGAGGCTGATGTCCTTCTTCC -3'
Posted On2014-03-14