Incidental Mutation 'R1405:Dstn'
ID160512
Institutional Source Beutler Lab
Gene Symbol Dstn
Ensembl Gene ENSMUSG00000015932
Gene Namedestrin
Synonymssid23p, ADF, corn1, 2610043P17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location143915320-143943324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143938436 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 19 (K19E)
Ref Sequence ENSEMBL: ENSMUSP00000099461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103172]
Predicted Effect probably damaging
Transcript: ENSMUST00000103172
AA Change: K19E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099461
Gene: ENSMUSG00000015932
AA Change: K19E

DomainStartEndE-ValueType
ADF 19 153 2.67e-52 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the actin-binding proteins ADF family. This family of proteins is responsible for enhancing the turnover rate of actin in vivo. This gene encodes the actin depolymerizing protein that severs actin filaments (F-actin) and binds to actin monomers (G-actin). Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying mutations at this locus develop irregular thickening of the corneal epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Dstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Dstn APN 2 143942174 missense probably benign
R0655:Dstn UTSW 2 143938422 missense probably damaging 1.00
R0849:Dstn UTSW 2 143938535 missense probably benign 0.42
R1405:Dstn UTSW 2 143938436 missense probably damaging 1.00
R1460:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R1541:Dstn UTSW 2 143938488 missense possibly damaging 0.78
R3882:Dstn UTSW 2 143942187 missense probably benign 0.20
R6419:Dstn UTSW 2 143939987 missense possibly damaging 0.75
R7402:Dstn UTSW 2 143938448 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCATGTGTGCTAGTCAGGAGTCAG -3'
(R):5'- GTGCTCACCACAGGAAGAACATCAG -3'

Sequencing Primer
(F):5'- CTAGTCAGGAGTCAGTAATGCTCAC -3'
(R):5'- GCGACAATCTTTTTCAGGAAGC -3'
Posted On2014-03-14