Incidental Mutation 'R1405:Zxdc'
ID160518
Institutional Source Beutler Lab
Gene Symbol Zxdc
Ensembl Gene ENSMUSG00000034430
Gene NameZXD family zinc finger C
SynonymsB930086F11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location90369492-90403490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90384243 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 737 (S737G)
Ref Sequence ENSEMBL: ENSMUSP00000074619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045740] [ENSMUST00000075117] [ENSMUST00000113539]
Predicted Effect probably benign
Transcript: ENSMUST00000045740
SMART Domains Protein: ENSMUSP00000036329
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000075117
AA Change: S737G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074619
Gene: ENSMUSG00000034430
AA Change: S737G

DomainStartEndE-ValueType
low complexity region 22 73 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 134 152 N/A INTRINSIC
ZnF_C2H2 176 200 4.79e-3 SMART
ZnF_C2H2 209 233 4.3e-5 SMART
ZnF_C2H2 239 263 4.3e-5 SMART
ZnF_C2H2 269 291 1.69e-3 SMART
ZnF_C2H2 298 322 1.82e-3 SMART
ZnF_C2H2 329 353 1.26e-2 SMART
ZnF_C2H2 359 383 1.36e-2 SMART
ZnF_C2H2 389 413 5.21e-4 SMART
ZnF_C2H2 419 443 4.72e-2 SMART
ZnF_C2H2 452 477 3.07e-1 SMART
low complexity region 487 502 N/A INTRINSIC
low complexity region 635 651 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113539
SMART Domains Protein: ENSMUSP00000109167
Gene: ENSMUSG00000034430

DomainStartEndE-ValueType
low complexity region 44 95 N/A INTRINSIC
low complexity region 127 137 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
ZnF_C2H2 198 222 4.79e-3 SMART
ZnF_C2H2 231 255 4.3e-5 SMART
ZnF_C2H2 261 285 4.3e-5 SMART
ZnF_C2H2 291 313 1.69e-3 SMART
ZnF_C2H2 320 344 1.82e-3 SMART
ZnF_C2H2 351 375 1.26e-2 SMART
ZnF_C2H2 381 405 1.36e-2 SMART
ZnF_C2H2 411 435 5.21e-4 SMART
ZnF_C2H2 441 465 4.72e-2 SMART
ZnF_C2H2 474 499 3.07e-1 SMART
low complexity region 509 524 N/A INTRINSIC
low complexity region 657 673 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203368
Predicted Effect probably benign
Transcript: ENSMUST00000203493
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Other mutations in Zxdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Zxdc APN 6 90373779 missense probably damaging 1.00
IGL01943:Zxdc APN 6 90372538 intron probably benign
IGL02406:Zxdc APN 6 90398836 missense probably benign 0.00
IGL02596:Zxdc APN 6 90373709 critical splice acceptor site probably null
IGL02623:Zxdc APN 6 90382370 missense probably damaging 0.99
IGL02927:Zxdc APN 6 90372562 missense probably damaging 1.00
IGL03230:Zxdc APN 6 90373803 missense probably damaging 1.00
PIT4378001:Zxdc UTSW 6 90373716 missense probably damaging 1.00
R0071:Zxdc UTSW 6 90370416 missense probably damaging 1.00
R0194:Zxdc UTSW 6 90372537 intron probably benign
R1065:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1377:Zxdc UTSW 6 90378903 missense probably damaging 1.00
R1405:Zxdc UTSW 6 90384243 missense possibly damaging 0.50
R1692:Zxdc UTSW 6 90378951 nonsense probably null
R2171:Zxdc UTSW 6 90382479 missense possibly damaging 0.53
R3952:Zxdc UTSW 6 90370467 intron probably null
R4400:Zxdc UTSW 6 90369810 missense probably damaging 1.00
R4660:Zxdc UTSW 6 90378838 missense probably damaging 0.99
R4776:Zxdc UTSW 6 90370518 missense probably damaging 1.00
R4781:Zxdc UTSW 6 90372553 missense probably damaging 0.98
R4843:Zxdc UTSW 6 90382272 missense possibly damaging 0.94
R5028:Zxdc UTSW 6 90382338 missense probably benign 0.44
R5260:Zxdc UTSW 6 90382093 missense probably damaging 1.00
R5279:Zxdc UTSW 6 90370437 missense possibly damaging 0.86
R5324:Zxdc UTSW 6 90373800 missense probably damaging 1.00
R5363:Zxdc UTSW 6 90382146 missense probably damaging 0.97
R5436:Zxdc UTSW 6 90370560 missense probably damaging 0.99
R5872:Zxdc UTSW 6 90370299 missense probably damaging 0.99
R5940:Zxdc UTSW 6 90370325 missense probably damaging 1.00
R6762:Zxdc UTSW 6 90382183 missense probably benign
R7175:Zxdc UTSW 6 90369663 missense possibly damaging 0.85
R7197:Zxdc UTSW 6 90378837 missense probably damaging 0.99
R7238:Zxdc UTSW 6 90369660 missense unknown
R7247:Zxdc UTSW 6 90384173 missense unknown
Predicted Primers PCR Primer
(F):5'- TACATTGCCAGGCAGGCTTAGTCC -3'
(R):5'- CTGATTCAACCAAAGACTGCTGCAC -3'

Sequencing Primer
(F):5'- AGGCTTAGTCCCCTTGCTAC -3'
(R):5'- AGAACTGACCCTGTTTGGACC -3'
Posted On2014-03-14