Incidental Mutation 'R1405:Nrg1'
ID160526
Institutional Source Beutler Lab
Gene Symbol Nrg1
Ensembl Gene ENSMUSG00000062991
Gene Nameneuregulin 1
SynonymsD230005F13Rik, Hgl, GGF, HRGalpha, ARIA, 6030402G23Rik, HRG, GGFII, HGL, NDF, SMDF, heregulin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location31814551-32884029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31917827 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000073546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073884] [ENSMUST00000207417] [ENSMUST00000207470] [ENSMUST00000208205] [ENSMUST00000208488] [ENSMUST00000208497] [ENSMUST00000208598] [ENSMUST00000208617] [ENSMUST00000208819] [ENSMUST00000208931] [ENSMUST00000209022] [ENSMUST00000209107]
Predicted Effect probably benign
Transcript: ENSMUST00000073884
AA Change: D126G

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000073546
Gene: ENSMUSG00000062991
AA Change: D126G

DomainStartEndE-ValueType
transmembrane domain 78 100 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
EGF 236 277 7.88e-4 SMART
Pfam:Neuregulin 295 688 5.3e-193 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207417
Predicted Effect probably benign
Transcript: ENSMUST00000207470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207678
Predicted Effect probably benign
Transcript: ENSMUST00000208205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208206
Predicted Effect probably benign
Transcript: ENSMUST00000208335
Predicted Effect probably benign
Transcript: ENSMUST00000208488
Predicted Effect probably benign
Transcript: ENSMUST00000208497
AA Change: D126G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000208598
Predicted Effect probably benign
Transcript: ENSMUST00000208617
Predicted Effect probably benign
Transcript: ENSMUST00000208819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208820
Predicted Effect probably benign
Transcript: ENSMUST00000208931
Predicted Effect probably benign
Transcript: ENSMUST00000209022
Predicted Effect probably benign
Transcript: ENSMUST00000209107
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Nrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Nrg1 APN 8 31818089 missense probably damaging 0.99
IGL00500:Nrg1 APN 8 31822314 unclassified probably null
IGL01150:Nrg1 APN 8 31917875 missense probably damaging 1.00
IGL01998:Nrg1 APN 8 31918134 missense probably damaging 0.99
IGL02010:Nrg1 APN 8 31918143 missense probably benign 0.00
IGL02501:Nrg1 APN 8 31818263 unclassified probably null
IGL02741:Nrg1 APN 8 31822288 missense probably damaging 1.00
IGL02754:Nrg1 APN 8 31826363 splice site probably benign
IGL03056:Nrg1 APN 8 31821423 missense possibly damaging 0.93
IGL03121:Nrg1 APN 8 31824580 splice site probably benign
R6805_Nrg1_535 UTSW 8 31821264 missense probably damaging 1.00
R0533:Nrg1 UTSW 8 31831245 intron probably null
R1170:Nrg1 UTSW 8 31837667 splice site probably benign
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1486:Nrg1 UTSW 8 31818344 missense probably damaging 1.00
R1642:Nrg1 UTSW 8 31824508 missense probably benign 0.45
R1653:Nrg1 UTSW 8 31818653 missense probably damaging 1.00
R1762:Nrg1 UTSW 8 31822323 missense probably damaging 0.99
R1951:Nrg1 UTSW 8 31918193 missense probably damaging 1.00
R2060:Nrg1 UTSW 8 31918015 missense probably damaging 1.00
R2912:Nrg1 UTSW 8 31818567 missense probably damaging 1.00
R3786:Nrg1 UTSW 8 31821383 missense probably damaging 1.00
R4513:Nrg1 UTSW 8 32477077 intron probably benign
R4569:Nrg1 UTSW 8 31917774 missense probably benign 0.00
R4760:Nrg1 UTSW 8 31918200 nonsense probably null
R4769:Nrg1 UTSW 8 31917972 missense probably damaging 1.00
R4834:Nrg1 UTSW 8 31917719 missense probably benign
R5058:Nrg1 UTSW 8 31824559 missense probably damaging 1.00
R5230:Nrg1 UTSW 8 31818479 missense probably damaging 0.99
R5443:Nrg1 UTSW 8 31849320 missense probably damaging 1.00
R5479:Nrg1 UTSW 8 31818377 missense probably damaging 1.00
R5940:Nrg1 UTSW 8 31849344 missense probably damaging 0.99
R6010:Nrg1 UTSW 8 31818572 missense probably damaging 1.00
R6170:Nrg1 UTSW 8 31818480 missense probably damaging 1.00
R6379:Nrg1 UTSW 8 32883721 start gained probably benign
R6460:Nrg1 UTSW 8 31818533 missense probably damaging 1.00
R6750:Nrg1 UTSW 8 31818096 missense probably damaging 1.00
R6767:Nrg1 UTSW 8 31917895 missense probably damaging 1.00
R6802:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6804:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6805:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6848:Nrg1 UTSW 8 31818056 missense probably damaging 1.00
R6930:Nrg1 UTSW 8 31818506 missense probably damaging 1.00
R6963:Nrg1 UTSW 8 31917662 missense probably benign 0.04
R7070:Nrg1 UTSW 8 31849437 missense probably damaging 0.99
R7176:Nrg1 UTSW 8 31968036 nonsense probably null
R7490:Nrg1 UTSW 8 31818654 missense probably damaging 1.00
R7526:Nrg1 UTSW 8 31818323 missense probably benign 0.00
R7664:Nrg1 UTSW 8 32009141 utr 5 prime probably null
R7881:Nrg1 UTSW 8 31838324 nonsense probably null
R7964:Nrg1 UTSW 8 31838324 nonsense probably null
R8013:Nrg1 UTSW 8 31949923 missense probably benign 0.41
Z1088:Nrg1 UTSW 8 31918005 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AACCTGGCTACATGGAGTTGCTG -3'
(R):5'- CTCCGAGAAGATCTGCATTGTTCCC -3'

Sequencing Primer
(F):5'- GCTGTTAAAAGACCTGATTCATCC -3'
(R):5'- GAAGATCTGCATTGTTCCCATTCTG -3'
Posted On2014-03-14