Incidental Mutation 'R1405:Hmg20a'
ID160528
Institutional Source Beutler Lab
Gene Symbol Hmg20a
Ensembl Gene ENSMUSG00000032329
Gene Namehigh mobility group 20A
SynonymsHmgxb1, 5730490E10Rik, 1200004E06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56418609-56496936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56477303 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 119 (Q119L)
Ref Sequence ENSEMBL: ENSMUSP00000149359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034879] [ENSMUST00000213242] [ENSMUST00000214771] [ENSMUST00000214869] [ENSMUST00000215269] [ENSMUST00000217518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034879
AA Change: Q119L

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034879
Gene: ENSMUSG00000032329
AA Change: Q119L

DomainStartEndE-ValueType
low complexity region 80 94 N/A INTRINSIC
HMG 101 171 1.86e-21 SMART
coiled coil region 228 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213242
Predicted Effect probably benign
Transcript: ENSMUST00000214771
AA Change: Q119L

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000214869
Predicted Effect possibly damaging
Transcript: ENSMUST00000215269
AA Change: Q119L

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217518
AA Change: Q119L

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Hmg20a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Hmg20a APN 9 56487650 missense probably damaging 1.00
IGL01981:Hmg20a APN 9 56477230 missense probably damaging 1.00
IGL02085:Hmg20a APN 9 56477302 nonsense probably null
IGL03284:Hmg20a APN 9 56481617 missense probably benign 0.25
ANU22:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
P0033:Hmg20a UTSW 9 56489824 missense probably benign 0.01
R0369:Hmg20a UTSW 9 56487650 missense probably damaging 1.00
R0710:Hmg20a UTSW 9 56474670 missense possibly damaging 0.84
R1405:Hmg20a UTSW 9 56477303 missense possibly damaging 0.66
R1546:Hmg20a UTSW 9 56467401 missense possibly damaging 0.56
R2188:Hmg20a UTSW 9 56477300 missense possibly damaging 0.93
R4730:Hmg20a UTSW 9 56467419 missense possibly damaging 0.85
R4956:Hmg20a UTSW 9 56481664 missense probably damaging 1.00
R6115:Hmg20a UTSW 9 56489832 missense possibly damaging 0.95
R6130:Hmg20a UTSW 9 56488607 splice site probably null
R6152:Hmg20a UTSW 9 56481608 missense probably damaging 1.00
R6961:Hmg20a UTSW 9 56488728 missense probably benign 0.29
R7499:Hmg20a UTSW 9 56488943 missense unknown
Predicted Primers PCR Primer
(F):5'- GCACCTCGTGTCCTATTTGACGTTC -3'
(R):5'- TGTGCTACCACCCAAACCCCTT -3'

Sequencing Primer
(F):5'- TGTTACTATTGCTGATGACTTACTTG -3'
(R):5'- gctttttctgcctcaaccc -3'
Posted On2014-03-14