Incidental Mutation 'R1405:Larp6'
ID160529
Institutional Source Beutler Lab
Gene Symbol Larp6
Ensembl Gene ENSMUSG00000034839
Gene NameLa ribonucleoprotein domain family, member 6
SynonymsAchn, acheron, 5430431G03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location60712989-60738801 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60737566 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 330 (M330L)
Ref Sequence ENSEMBL: ENSMUSP00000040309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038407]
Predicted Effect probably benign
Transcript: ENSMUST00000038407
AA Change: M330L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040309
Gene: ENSMUSG00000034839
AA Change: M330L

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
LA 90 170 2.44e-40 SMART
Blast:RRM 209 276 6e-9 BLAST
SCOP:d1urna_ 210 288 1e-3 SMART
low complexity region 294 304 N/A INTRINSIC
low complexity region 332 346 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
Pfam:SUZ-C 453 483 1.6e-10 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Larp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Larp6 APN 9 60713312 missense probably benign 0.08
R1405:Larp6 UTSW 9 60737566 missense probably benign
R4463:Larp6 UTSW 9 60736996 missense probably damaging 1.00
R4860:Larp6 UTSW 9 60737810 missense probably damaging 0.99
R4860:Larp6 UTSW 9 60737810 missense probably damaging 0.99
R4948:Larp6 UTSW 9 60737780 missense possibly damaging 0.89
R5132:Larp6 UTSW 9 60737210 missense probably damaging 1.00
R6285:Larp6 UTSW 9 60737760 missense probably benign 0.28
R6370:Larp6 UTSW 9 60737363 missense probably damaging 1.00
R7088:Larp6 UTSW 9 60724355 missense probably damaging 1.00
R7243:Larp6 UTSW 9 60713286 missense probably benign 0.00
R7535:Larp6 UTSW 9 60724154 missense probably benign 0.10
R7998:Larp6 UTSW 9 60724355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGTGATGGAGCATCTGCTCAAG -3'
(R):5'- GGCTGGTGCTGAAGTTCAGTCTAC -3'

Sequencing Primer
(F):5'- CAAGAGTGCGCCATTGTG -3'
(R):5'- TTCTGGAGACACCCTTGCG -3'
Posted On2014-03-14