Incidental Mutation 'R1405:Serpinb9e'
ID160536
Institutional Source Beutler Lab
Gene Symbol Serpinb9e
Ensembl Gene ENSMUSG00000062342
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9e
SynonymsSpi14, ovalbumin, NK26
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33249612-33260850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33260026 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 343 (D343G)
Ref Sequence ENSEMBL: ENSMUSP00000071769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071873]
Predicted Effect probably benign
Transcript: ENSMUST00000071873
AA Change: D343G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071769
Gene: ENSMUSG00000062342
AA Change: D343G

DomainStartEndE-ValueType
SERPIN 13 377 1.82e-168 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tmprss2 G A 16: 97,596,805 T57I probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Serpinb9e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Serpinb9e APN 13 33255125 missense probably damaging 0.97
IGL02352:Serpinb9e APN 13 33257820 splice site probably benign
IGL02359:Serpinb9e APN 13 33257820 splice site probably benign
IGL02604:Serpinb9e APN 13 33257759 missense probably benign 0.00
IGL02859:Serpinb9e APN 13 33251650 missense possibly damaging 0.83
R0257:Serpinb9e UTSW 13 33257681 missense probably benign 0.24
R0751:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1101:Serpinb9e UTSW 13 33260088 missense probably benign 0.10
R1170:Serpinb9e UTSW 13 33257752 nonsense probably null
R1184:Serpinb9e UTSW 13 33259774 missense probably benign 0.00
R1253:Serpinb9e UTSW 13 33255119 missense possibly damaging 0.77
R1405:Serpinb9e UTSW 13 33260026 missense probably benign
R1463:Serpinb9e UTSW 13 33255116 missense probably benign
R1566:Serpinb9e UTSW 13 33253494 missense probably damaging 1.00
R1924:Serpinb9e UTSW 13 33253445 missense probably benign 0.07
R1964:Serpinb9e UTSW 13 33253491 missense probably benign 0.04
R2153:Serpinb9e UTSW 13 33252978 missense probably damaging 1.00
R2405:Serpinb9e UTSW 13 33260080 missense probably benign
R2972:Serpinb9e UTSW 13 33255143 missense probably benign
R2973:Serpinb9e UTSW 13 33255143 missense probably benign
R2974:Serpinb9e UTSW 13 33255143 missense probably benign
R3854:Serpinb9e UTSW 13 33255154 missense probably benign 0.40
R4173:Serpinb9e UTSW 13 33255158 missense probably damaging 0.97
R4937:Serpinb9e UTSW 13 33252952 missense probably benign 0.11
R4949:Serpinb9e UTSW 13 33251608 missense possibly damaging 0.81
R5347:Serpinb9e UTSW 13 33257784 missense probably damaging 1.00
R5976:Serpinb9e UTSW 13 33255129 missense probably benign
R5979:Serpinb9e UTSW 13 33255053 missense probably benign 0.18
R5991:Serpinb9e UTSW 13 33259807 missense probably damaging 1.00
R6059:Serpinb9e UTSW 13 33257774 missense probably benign 0.29
R6884:Serpinb9e UTSW 13 33251626 missense probably benign 0.33
R8007:Serpinb9e UTSW 13 33251622 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTTAACAGCCTGGACCAAACCAGAG -3'
(R):5'- CCACTTGTCCATTCTCACAGAGCAG -3'

Sequencing Primer
(F):5'- CTGGACCAAACCAGAGTTTATG -3'
(R):5'- TCCATTCTCACAGAGCAGTAGAAG -3'
Posted On2014-03-14