Incidental Mutation 'R1405:Tmprss2'
ID160542
Institutional Source Beutler Lab
Gene Symbol Tmprss2
Ensembl Gene ENSMUSG00000000385
Gene Nametransmembrane protease, serine 2
Synonymsepitheliasin, D16Ertd61e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1405 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location97564682-97611195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97596805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 57 (T57I)
Ref Sequence ENSEMBL: ENSMUSP00000156304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000395] [ENSMUST00000232141]
Predicted Effect probably benign
Transcript: ENSMUST00000000395
AA Change: T57I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000000395
Gene: ENSMUSG00000000385
AA Change: T57I

DomainStartEndE-ValueType
transmembrane domain 86 108 N/A INTRINSIC
LDLa 111 149 1e-9 SMART
SR 148 241 8.55e-10 SMART
Tryp_SPc 253 482 4.58e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231908
Predicted Effect probably benign
Transcript: ENSMUST00000232141
AA Change: T57I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 96.7%
  • 10x: 83.5%
  • 20x: 53.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine protease family. The encoded protein contains a type II transmembrane domain, a receptor class A domain, a scavenger receptor cysteine-rich domain and a protease domain. Serine proteases are known to be involved in many physiological and pathological processes. This gene was demonstrated to be up-regulated by androgenic hormones in prostate cancer cells and down-regulated in androgen-independent prostate cancer tissue. The protease domain of this protein is thought to be cleaved and secreted into cell media after autocleavage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap1 G A 7: 101,398,436 probably null Het
Asb8 G A 15: 98,141,367 H51Y possibly damaging Het
Capn10 T G 1: 92,945,022 V490G probably benign Het
Ccdc146 G A 5: 21,399,732 S36L probably benign Het
Celsr1 C T 15: 85,905,434 probably null Het
Clvs2 C A 10: 33,513,260 *328L probably null Het
Cul9 C G 17: 46,522,175 A1326P probably damaging Het
Dstn A G 2: 143,938,436 K19E probably damaging Het
Ehmt2 T A 17: 34,906,577 H134Q probably benign Het
Faah G A 4: 116,001,148 P411S probably damaging Het
Fn1 A G 1: 71,642,078 F364L probably damaging Het
Gm14124 T A 2: 150,267,700 Y103* probably null Het
Gmnc A T 16: 26,960,446 N270K possibly damaging Het
Grip2 A T 6: 91,788,152 probably null Het
Hmg20a A T 9: 56,477,303 Q119L possibly damaging Het
Ipo7 T C 7: 110,029,841 I106T probably benign Het
Ipo7 C T 7: 110,039,249 P241L probably damaging Het
Katnb1 T C 8: 95,098,173 Y574H probably damaging Het
Larp6 A C 9: 60,737,566 M330L probably benign Het
Lrrc8e T C 8: 4,231,754 Y30H probably damaging Het
Nop56 T C 2: 130,277,948 V420A probably benign Het
Nrg1 T C 8: 31,917,827 D126G probably benign Het
Prdm1 T A 10: 44,439,965 N725I probably damaging Het
Prl3a1 A G 13: 27,275,068 probably null Het
Psmd2 T C 16: 20,652,284 L59P possibly damaging Het
Ptgdr2 T C 19: 10,941,031 V304A probably benign Het
Rasa3 A G 8: 13,588,027 V339A possibly damaging Het
Sec24c G A 14: 20,692,525 probably null Het
Serpinb9e A G 13: 33,260,026 D343G probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sfi1 CCTCTC CCTCTCTC 11: 3,177,419 probably benign Het
Stab1 A C 14: 31,149,001 V1297G probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Vwa5b2 T A 16: 20,604,316 D1021E probably benign Het
Wdr46 C A 17: 33,949,083 P543Q probably damaging Het
Zfp287 T A 11: 62,728,311 D119V probably damaging Het
Zxdc A G 6: 90,384,243 S737G possibly damaging Het
Other mutations in Tmprss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Tmprss2 APN 16 97578595 nonsense probably null
IGL02130:Tmprss2 APN 16 97590889 missense probably damaging 1.00
IGL02149:Tmprss2 APN 16 97599279 utr 5 prime probably benign
IGL03080:Tmprss2 APN 16 97596844 missense probably damaging 0.98
PIT4480001:Tmprss2 UTSW 16 97599260 missense possibly damaging 0.77
R0395:Tmprss2 UTSW 16 97567045 missense probably damaging 1.00
R0485:Tmprss2 UTSW 16 97571994 unclassified probably benign
R1055:Tmprss2 UTSW 16 97576262 missense probably damaging 1.00
R1080:Tmprss2 UTSW 16 97591498 missense probably benign
R1405:Tmprss2 UTSW 16 97596805 missense probably benign 0.00
R1930:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1931:Tmprss2 UTSW 16 97569062 missense probably benign 0.17
R1955:Tmprss2 UTSW 16 97567177 critical splice acceptor site probably null
R2443:Tmprss2 UTSW 16 97568503 missense possibly damaging 0.65
R3825:Tmprss2 UTSW 16 97596821 missense probably damaging 1.00
R4508:Tmprss2 UTSW 16 97570427 missense probably damaging 1.00
R5212:Tmprss2 UTSW 16 97576292 missense probably benign 0.00
R5571:Tmprss2 UTSW 16 97590871 missense probably null 1.00
R5715:Tmprss2 UTSW 16 97568983 missense possibly damaging 0.65
R6816:Tmprss2 UTSW 16 97568467 missense possibly damaging 0.94
R6921:Tmprss2 UTSW 16 97568437 missense probably damaging 0.98
R7230:Tmprss2 UTSW 16 97578597 missense probably benign 0.02
R7311:Tmprss2 UTSW 16 97568416 missense possibly damaging 0.94
R7788:Tmprss2 UTSW 16 97576229 nonsense probably null
R8052:Tmprss2 UTSW 16 97568416 missense probably damaging 1.00
Z1176:Tmprss2 UTSW 16 97567057 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGCAGTGCAGTGTTATTGACAAGG -3'
(R):5'- TGATTGGCAATCTGCTGGCTCTC -3'

Sequencing Primer
(F):5'- TGCAGTGTTATTGACAAGGTAGGAG -3'
(R):5'- GTGAGAGCTGTAACTGATTTATCTCC -3'
Posted On2014-03-14